5-140114295-GGGCGGCGGCGGCAGTGGCGGCGGCGGC-GGGCGGCGGCGGCAGTGGCGGCGGCGGCGGCGGCAGTGGCGGCGGCGGC

Variant names:

• chr5-140114295-G-GGGCGGCGGCGGCAGTGGCGGC
• rs750397204
• NM_005859.5:c.126_146dupCAGTGGCGGCGGCGGCGGCGG

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_005859.5(PURA):​c.126_146dupCAGTGGCGGCGGCGGCGGCGG​(p.Gly49_Ala50insSerGlyGlyGlyGlyGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000201 in 149,126 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. G49G) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000095 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PURA NM_005859.5 disruptive_inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.43
• Publications: 0 publications found

Genes affected

PURA (HGNC:9701): (purine rich element binding protein A) This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia. [provided by RefSeq, Jul 2008]

MALINC1 (HGNC:49009): (mitosis associated long intergenic non-coding RNA 1)

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 5-140114295-G-GGGCGGCGGCGGCAGTGGCGGC is Benign according to our data. Variant chr5-140114295-G-GGGCGGCGGCGGCAGTGGCGGC is described in ClinVar as Likely_benign. ClinVar VariationId is 639596.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005859.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PURA	NM_005859.5	MANE Select	c.126_146dupCAGTGGCGGCGGCGGCGGCGG	p.Gly49_Ala50insSerGlyGlyGlyGlyGlyGly	disruptive_inframe_insertion	Exon 1 of 1	NP_005850.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PURA	ENST00000331327.5	TSL:6 MANE Select	c.126_146dupCAGTGGCGGCGGCGGCGGCGG	p.Gly49_Ala50insSerGlyGlyGlyGlyGlyGly	disruptive_inframe_insertion	Exon 1 of 1	ENSP00000332706.3
	PURA	ENST00000651386.1		c.126_146dupCAGTGGCGGCGGCGGCGGCGG	p.Gly49_Ala50insSerGlyGlyGlyGlyGlyGly	disruptive_inframe_insertion	Exon 2 of 2	ENSP00000499133.1
	PURA	ENST00000505703.2	TSL:3	c.126_146dupCAGTGGCGGCGGCGGCGGCGG	p.Gly49_Ala50insSerGlyGlyGlyGlyGlyGly	disruptive_inframe_insertion	Exon 2 of 2	ENSP00000498560.1

Frequencies

GnomAD3 genomes AF: 0.0000201 AC: 3 AN: 149126 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000449

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000950 AC: 105 AN: 1105424 Hom.: 0 Cov.: 31 AF XY: 0.000107 AC XY: 57 AN XY: 531428

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 22674

American (AMR) AF: 0.00 AC: 0 AN: 8398

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 13990

East Asian (EAS) AF: 0.00 AC: 0 AN: 25856

South Asian (SAS) AF: 0.00 AC: 0 AN: 24734

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22106

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3174

European-Non Finnish (NFE) AF: 0.000108 AC: 102 AN: 940212

Other (OTH) AF: 0.0000678 AC: 3 AN: 44280

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000201 AC: 3 AN: 149126 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 72718

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 40818

American (AMR) AF: 0.00 AC: 0 AN: 15006

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3416

East Asian (EAS) AF: 0.00 AC: 0 AN: 5138

South Asian (SAS) AF: 0.00 AC: 0 AN: 4754

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9902

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000449 AC: 3 AN: 66838

Other (OTH) AF: 0.00 AC: 0 AN: 2040

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.0662318), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome Benign:1

Apr 25, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=74/26	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs750397204; hg19: chr5-139493880;