rs750397204

Variant names:

• chr5-140114295-GGGCGGCGGCGGCAGTGGCGGCGGCGGC-G
• rs750397204
• NM_005859.5:c.120_146delCGGCGGCAGTGGCGGCGGCGGCGGCGG

Your query was ambiguous. Multiple possible variants found:

• chr5-140114295-GGGCGGCGGCGGCAGTGGCGGCGGCGGC-G
• chr5-140114295-GGGCGGCGGCGGCAGTGGCGGCGGCGGC-GGGC
• chr5-140114295-GGGCGGCGGCGGCAGTGGCGGCGGCGGC-GGGCGGC
• chr5-140114295-GGGCGGCGGCGGCAGTGGCGGCGGCGGC-GGGCGGCGGCGGCAGTGGCGGCGGCGGCGGCGGCAGTGGCGGCGGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_005859.5(PURA):​c.120_146delCGGCGGCAGTGGCGGCGGCGGCGGCGG​(p.Gly41_Gly49del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000271 in 1,105,442 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: PURA NM_005859.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.66
• Publications: 0 publications found

Genes affected

PURA (HGNC:9701): (purine rich element binding protein A) This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia. [provided by RefSeq, Jul 2008]

MALINC1 (HGNC:49009): (mitosis associated long intergenic non-coding RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PURA	NM_005859.5	c.120_146delCGGCGGCAGTGGCGGCGGCGGCGGCGG	p.Gly41_Gly49del	disruptive_inframe_deletion	Exon 1 of 1	ENST00000331327.5	NP_005850.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PURA	ENST00000331327.5	c.120_146delCGGCGGCAGTGGCGGCGGCGGCGGCGG	p.Gly41_Gly49del	disruptive_inframe_deletion	Exon 1 of 1	6	NM_005859.5	ENSP00000332706.3

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD2 exomes AF: 0.000140 AC: 1 AN: 7138 AF XY: 0.000220

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00301

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000271 AC: 3 AN: 1105442 Hom.: 0 AF XY: 0.00000376 AC XY: 2 AN XY: 531434

African (AFR) AF: 0.00 AC: 0 AN: 22674

American (AMR) AF: 0.00 AC: 0 AN: 8398

Ashkenazi Jewish (ASJ) AF: 0.0000715 AC: 1 AN: 13990

East Asian (EAS) AF: 0.0000387 AC: 1 AN: 25856

South Asian (SAS) AF: 0.00 AC: 0 AN: 24734

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22106

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3174

European-Non Finnish (NFE) AF: 0.00000106 AC: 1 AN: 940228

Other (OTH) AF: 0.00 AC: 0 AN: 44282

GnomAD4 genome Cov.: 31

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs750397204; hg19: chr5-139493880;