5-156327123-GGGCCTGCACACACTCAGCGGGCCGAGT-G

Position:

• chr5-156327123-GGGCCTGCACACACTCAGCGGGCCGAGT-G

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BS1_Supporting

The ENST00000435422(SGCD):​c.-105_-79delTGCACACACTCAGCGGGCCGAGTGGCC variant causes a 5 prime UTR change. The variant allele was found at a frequency of 0.000728 in 152,388 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as not provided (no stars).

• Frequency:
  • Genomes: 𝑓 0.00073 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SGCD ENST00000435422 5_prime_UTR
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 6.75

Genes affected

SGCD (HGNC:10807): (sarcoglycan delta) The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]

LOC124901120 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.000728 (111/152388) while in subpopulation NFE AF= 0.00132 (90/68040). AF 95% confidence interval is 0.0011. There are 0 homozygotes in gnomad4. There are 42 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SGCD	NM_000337.6	c.-152_-126delGGCCTGCACACACTCAGCGGGCCGAGT		upstream_gene_variant		ENST00000337851.9	NP_000328.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SGCD	ENST00000337851.9	c.-152_-126delGGCCTGCACACACTCAGCGGGCCGAGT		upstream_gene_variant		1	NM_000337.6	ENSP00000338343.4

Frequencies

GnomAD3 genomes AF: 0.000729 AC: 111 AN: 152270 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000458

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00132

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 92 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 62

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.000728 AC: 111 AN: 152388 Hom.: 0 Cov.: 33 AF XY: 0.000564 AC XY: 42 AN XY: 74528

Gnomad4 AFR AF: 0.000457

Gnomad4 AMR AF: 0.000131

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00132

Gnomad4 OTH AF: 0.00

Alfa AF: 0.00160 Hom.: 0

Bravo AF: 0.000672

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

not specified Other:1

not provided, no classification provided

clinical testing

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Apr 10, 2014

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs727504478; hg19: chr5-155754133;