chr5-156327123-GGGCCTGCACACACTCAGCGGGCCGAGT-G
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BS1_Supporting
The ENST00000524347.2(SGCD):n.-148_-122delTGCACACACTCAGCGGGCCGAGTGGCC variant causes a non coding transcript exon change. The variant allele was found at a frequency of 0.000728 in 152,388 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).
Frequency
Consequence
ENST00000524347.2 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive limb-girdle muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- autosomal recessive limb-girdle muscular dystrophy type 2FInheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Myriad Women’s Health, Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- dilated cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- dilated cardiomyopathy 1LInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000729 AC: 111AN: 152270Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 92Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 62
GnomAD4 genome AF: 0.000728 AC: 111AN: 152388Hom.: 0 Cov.: 33 AF XY: 0.000564 AC XY: 42AN XY: 74528 show subpopulations
ClinVar
Submissions by phenotype
not specified Other:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at