6-42965734-GTCCAGTTCATCAAAGAAGAT-GA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000287.4(PEX6):c.2398_2417delATCTTCTTTGATGAACTGGAinsT(p.Ile800SerfsTer16) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000287.4 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- peroxisome biogenesis disorderInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- peroxisome biogenesis disorder 4A (Zellweger)Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Myriad Women’s Health
- peroxisome biogenesis disorder 4BInheritance: AR Classification: DEFINITIVE Submitted by: G2P
- Heimler syndrome 2Inheritance: AR Classification: MODERATE Submitted by: G2P
- autosomal recessive cerebellar ataxia-blindness-deafness syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Zellweger spectrum disordersInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000287.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PEX6 | MANE Select | c.2398_2417delATCTTCTTTGATGAACTGGAinsT | p.Ile800SerfsTer16 | frameshift missense | Exon 13 of 17 | NP_000278.3 | |||
| PEX6 | c.2134_2153delATCTTCTTTGATGAACTGGAinsT | p.Ile712SerfsTer16 | frameshift missense | Exon 13 of 17 | NP_001303242.1 | Q13608-3 | |||
| PEX6 | n.2182_2201delATCTTCTTTGATGAACTGGAinsT | non_coding_transcript_exon | Exon 11 of 15 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PEX6 | TSL:1 MANE Select | c.2398_2417delATCTTCTTTGATGAACTGGAinsT | p.Ile800SerfsTer16 | frameshift missense | Exon 13 of 17 | ENSP00000303511.8 | Q13608-1 | ||
| PEX6 | TSL:1 | c.2151_2170delATCTTCTTTGATGAACTGGAinsT | p.Leu717PhefsTer60 | frameshift missense | Exon 11 of 15 | ENSP00000244546.4 | Q13608-2 | ||
| PEX6 | c.2437_2456delATCTTCTTTGATGAACTGGAinsT | p.Ile813SerfsTer16 | frameshift missense | Exon 13 of 17 | ENSP00000528715.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at