6-42965734-GTCCAGTTCATCAAAGAAGAT-GA

Variant names:

• chr6-42965735-TCCAGTTCATCAAAGAAGAT-A
• rs62653602
• NM_000287.4:c.2398_2417delATCTTCTTTGATGAACTGGAinsT

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000287.4(PEX6):​c.2398_2417delATCTTCTTTGATGAACTGGAinsT​(p.Ile800SerfsTer16) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PEX6 NM_000287.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

PEX6 (HGNC:8859): (peroxisomal biogenesis factor 6) This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

PEX6 Gene-Disease associations (from GenCC):

• peroxisome biogenesis disorder

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• peroxisome biogenesis disorder 4A (Zellweger)

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Myriad Women’s Health
• peroxisome biogenesis disorder 4B

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• Heimler syndrome 2

  Inheritance: AR Classification: MODERATE Submitted by: G2P
• autosomal recessive cerebellar ataxia-blindness-deafness syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Zellweger spectrum disorders

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 6-42965735-TCCAGTTCATCAAAGAAGAT-A is Pathogenic according to our data. Variant chr6-42965735-TCCAGTTCATCAAAGAAGAT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 598162.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000287.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEX6	NM_000287.4	MANE Select	c.2398_2417delATCTTCTTTGATGAACTGGAinsT	p.Ile800SerfsTer16	frameshift missense	Exon 13 of 17	NP_000278.3
	PEX6	NM_001316313.2		c.2134_2153delATCTTCTTTGATGAACTGGAinsT	p.Ile712SerfsTer16	frameshift missense	Exon 13 of 17	NP_001303242.1	Q13608-3
	PEX6	NR_133009.2		n.2182_2201delATCTTCTTTGATGAACTGGAinsT		non_coding_transcript_exon	Exon 11 of 15

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEX6	ENST00000304611.13	TSL:1 MANE Select	c.2398_2417delATCTTCTTTGATGAACTGGAinsT	p.Ile800SerfsTer16	frameshift missense	Exon 13 of 17	ENSP00000303511.8	Q13608-1
	PEX6	ENST00000244546.4	TSL:1	c.2151_2170delATCTTCTTTGATGAACTGGAinsT	p.Leu717PhefsTer60	frameshift missense	Exon 11 of 15	ENSP00000244546.4	Q13608-2
	PEX6	ENST00000858656.1		c.2437_2456delATCTTCTTTGATGAACTGGAinsT	p.Ile813SerfsTer16	frameshift missense	Exon 13 of 17	ENSP00000528715.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Peroxisome biogenesis disorder (2)
1	-	-	Heimler syndrome 2 (1)
1	-	-	not provided (1)
1	-	-	Peroxisome biogenesis disorder 4A (Zellweger) (1)
1	-	-	Peroxisome biogenesis disorder 4A (Zellweger);C3553937:Peroxisome biogenesis disorder 4B;C4225267:Heimler syndrome 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=0/200	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs62653602; hg19: chr6-42933473;