chr6-42965735-TCCAGTTCATCAAAGAAGAT-A

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000287.4(PEX6):​c.2398_2417delATCTTCTTTGATGAACTGGAinsT​(p.Ile800SerfsTer16) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

PEX6
NM_000287.4 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:6

Conservation

PhyloP100: 9.32

Publications

0 publications found
Variant links:
Genes affected
PEX6 (HGNC:8859): (peroxisomal biogenesis factor 6) This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PEX6 Gene-Disease associations (from GenCC):
  • peroxisome biogenesis disorder
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • peroxisome biogenesis disorder 4A (Zellweger)
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Myriad Women’s Health
  • peroxisome biogenesis disorder 4B
    Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
  • Heimler syndrome 2
    Inheritance: AR Classification: MODERATE Submitted by: G2P
  • autosomal recessive cerebellar ataxia-blindness-deafness syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • Zellweger spectrum disorders
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 6-42965735-TCCAGTTCATCAAAGAAGAT-A is Pathogenic according to our data. Variant chr6-42965735-TCCAGTTCATCAAAGAAGAT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 598162.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PEX6NM_000287.4 linkc.2398_2417delATCTTCTTTGATGAACTGGAinsT p.Ile800SerfsTer16 frameshift_variant, missense_variant Exon 13 of 17 ENST00000304611.13 NP_000278.3 Q13608-1A0A024RD09

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PEX6ENST00000304611.13 linkc.2398_2417delATCTTCTTTGATGAACTGGAinsT p.Ile800SerfsTer16 frameshift_variant, missense_variant Exon 13 of 17 1 NM_000287.4 ENSP00000303511.8 Q13608-1
PEX6ENST00000244546.4 linkc.2151_2170delATCTTCTTTGATGAACTGGAinsT p.Leu717PhefsTer60 frameshift_variant, missense_variant Exon 11 of 15 1 ENSP00000244546.4 Q13608-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:6
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Peroxisome biogenesis disorder Pathogenic:2
Aug 17, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Ile800Serfs*16) in the PEX6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PEX6 are known to be pathogenic (PMID: 10408779, 21031596, 31831025). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with clinical features of Zellweger spectrum disorder (PMID: 8670792, 19877282). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. For these reasons, this variant has been classified as Pathogenic. -

May 05, 2021
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: PEX6 c.2398_2417delinsT (p.Ile800SerfsX16) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 251688 control chromosomes (gnomAD and publication data). c.2398_2417delinsT has been reported in the literature in individuals affected with Peroxisome Biogenesis Disorder or Zellweger Syndrome (Yahraus_1996, Steinberg_2004, Ebberink_2010). These data indicate that the variant is likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Peroxisome biogenesis disorder 4A (Zellweger);C3553937:Peroxisome biogenesis disorder 4B;C4225267:Heimler syndrome 2 Pathogenic:1
Jan 08, 2024
Fulgent Genetics, Fulgent Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Peroxisome biogenesis disorder 4A (Zellweger) Pathogenic:1
Jun 17, 1996
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Heimler syndrome 2 Pathogenic:1
Feb 21, 2024
Baylor Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

not provided Pathogenic:1
Jul 24, 2018
Eurofins Ntd Llc (ga)
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3
Mutation Taster
=0/200
disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs62653602; hg19: chr6-42933473; API