rs62653602

Variant names:

• chr6-42965735-TCCAGTTCATCAAAGAAGAT-A
• rs62653602
• NM_000287.4:c.2398_2417delATCTTCTTTGATGAACTGGAinsT

Your query was ambiguous. Multiple possible variants found:

• chr6-42965734-GTCCAGTTCATCAAAGAAGAT-GA
• chr6-42965734-GTCCAGTTCATCAAAGAAGAT-GT

Variant summary

Our verdict is Pathogenic. Variant got 22 ACMG points: 22P and 0B. PVS1 PS1 PM2 PP5_Very_Strong

The NM_000287.4(PEX6):​c.2398_2417delATCTTCTTTGATGAACTGGAinsT​(p.Ile800SerfsTer16) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Another nucleotide change resulting in the same amino acid substitution has been previously reported as Pathogenic in Lovd. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PEX6 NM_000287.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 9.32

Genes affected

PEX6 (HGNC:8859): (peroxisomal biogenesis factor 6) This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Pathogenic. Variant got 22 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PS1: Transcript NM_000287.4 (PEX6) is affected with MISSENSE_VARIANT having same AA change as one Pathogenic present in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 6-42965735-TCCAGTTCATCAAAGAAGAT-A is Pathogenic according to our data. Variant chr6-42965735-TCCAGTTCATCAAAGAAGAT-A is described in ClinVar as [Pathogenic]. Clinvar id is 598162.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PEX6	NM_000287.4	c.2398_2417delATCTTCTTTGATGAACTGGAinsT	p.Ile800SerfsTer16	frameshift_variant, missense_variant	Exon 13 of 17	ENST00000304611.13	NP_000278.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PEX6	ENST00000304611.13	c.2398_2417delATCTTCTTTGATGAACTGGAinsT	p.Ile800SerfsTer16	frameshift_variant, missense_variant	Exon 13 of 17	1	NM_000287.4	ENSP00000303511.8
PEX6	ENST00000244546.4	c.2151_2170delATCTTCTTTGATGAACTGGAinsT	p.Leu717PhefsTer60	frameshift_variant, missense_variant	Exon 11 of 15	1		ENSP00000244546.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Peroxisome biogenesis disorder Pathogenic:2

May 05, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: PEX6 c.2398_2417delinsT (p.Ile800SerfsX16) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 251688 control chromosomes (gnomAD and publication data). c.2398_2417delinsT has been reported in the literature in individuals affected with Peroxisome Biogenesis Disorder or Zellweger Syndrome (Yahraus_1996, Steinberg_2004, Ebberink_2010). These data indicate that the variant is likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Aug 17, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ile800Serfs*16) in the PEX6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PEX6 are known to be pathogenic (PMID: 10408779, 21031596, 31831025). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with clinical features of Zellweger spectrum disorder (PMID: 8670792, 19877282). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. For these reasons, this variant has been classified as Pathogenic. -

Peroxisome biogenesis disorder 4A (Zellweger);C3553937:Peroxisome biogenesis disorder 4B;C4225267:Heimler syndrome 2 Pathogenic:1

Jan 08, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Peroxisome biogenesis disorder 4A (Zellweger) Pathogenic:1

Jun 17, 1996

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Heimler syndrome 2 Pathogenic:1

Feb 21, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Jul 24, 2018

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs62653602; hg19: chr6-42933473;