NM_000287.4:c.2398_2417delATCTTCTTTGATGAACTGGAinsT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000287.4(PEX6):c.2398_2417delATCTTCTTTGATGAACTGGAinsT(p.Ile800SerfsTer16) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000287.4 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- peroxisome biogenesis disorderInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- peroxisome biogenesis disorder 4A (Zellweger)Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Myriad Women’s Health
- peroxisome biogenesis disorder 4BInheritance: AR Classification: DEFINITIVE Submitted by: G2P
- Heimler syndrome 2Inheritance: AR Classification: MODERATE Submitted by: G2P
- autosomal recessive cerebellar ataxia-blindness-deafness syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Zellweger spectrum disordersInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PEX6 | NM_000287.4 | c.2398_2417delATCTTCTTTGATGAACTGGAinsT | p.Ile800SerfsTer16 | frameshift_variant, missense_variant | Exon 13 of 17 | ENST00000304611.13 | NP_000278.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PEX6 | ENST00000304611.13 | c.2398_2417delATCTTCTTTGATGAACTGGAinsT | p.Ile800SerfsTer16 | frameshift_variant, missense_variant | Exon 13 of 17 | 1 | NM_000287.4 | ENSP00000303511.8 | ||
PEX6 | ENST00000244546.4 | c.2151_2170delATCTTCTTTGATGAACTGGAinsT | p.Leu717PhefsTer60 | frameshift_variant, missense_variant | Exon 11 of 15 | 1 | ENSP00000244546.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Peroxisome biogenesis disorder Pathogenic:2
This sequence change creates a premature translational stop signal (p.Ile800Serfs*16) in the PEX6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PEX6 are known to be pathogenic (PMID: 10408779, 21031596, 31831025). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with clinical features of Zellweger spectrum disorder (PMID: 8670792, 19877282). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. For these reasons, this variant has been classified as Pathogenic. -
Variant summary: PEX6 c.2398_2417delinsT (p.Ile800SerfsX16) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 251688 control chromosomes (gnomAD and publication data). c.2398_2417delinsT has been reported in the literature in individuals affected with Peroxisome Biogenesis Disorder or Zellweger Syndrome (Yahraus_1996, Steinberg_2004, Ebberink_2010). These data indicate that the variant is likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
Peroxisome biogenesis disorder 4A (Zellweger);C3553937:Peroxisome biogenesis disorder 4B;C4225267:Heimler syndrome 2 Pathogenic:1
- -
Peroxisome biogenesis disorder 4A (Zellweger) Pathogenic:1
- -
Heimler syndrome 2 Pathogenic:1
- -
not provided Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at