8-1763875-TGGCAGCCCAGGTGAGCGCTCA-T

Variant names:

• chr8-1763875-TGGCAGCCCAGGTGAGCGCTCA-T
• rs1554446821
• NM_018941.4:c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_018941.4(CLN8):​c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 28)
• Consequence: CLN8 NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 0.514
• Publications: 0 publications found

Genes affected

CLN8 (HGNC:2079): (CLN8 transmembrane ER and ERGIC protein) This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with a disorder characterized by progressive epilepsy with cognitive disabilities (EPMR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2017]

KBTBD11-OT1 (HGNC:):

CLN8-AS1 (HGNC:55523): (CLN8 antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1126597 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.5, offset of 0 (no position change), new splice context is: cggGTgagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018941.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLN8	NM_018941.4	MANE Select	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_region	Exon 1 of 3	NP_061764.2
	CLN8	NM_018941.4	MANE Select	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_donor splice_region 5_prime_UTR intron	Exon 1 of 3	NP_061764.2
	CLN8	NM_018941.4	MANE Select	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		non_coding_transcript	N/A	NP_061764.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLN8	ENST00000331222.6	TSL:1 MANE Select	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_region	Exon 1 of 3	ENSP00000328182.4	Q9UBY8
	CLN8	ENST00000331222.6	TSL:1 MANE Select	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_donor splice_region 5_prime_UTR intron	Exon 1 of 3	ENSP00000328182.4	Q9UBY8
	CLN8	ENST00000331222.6	TSL:1 MANE Select	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		non_coding_transcript	N/A	ENSP00000328182.4	Q9UBY8

Frequencies

GnomAD3 genomes Cov.: 28

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 28

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Neuronal ceroid lipofuscinosis 8 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.51

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554446821; hg19: chr8-1712041;