chr8-1763875-TGGCAGCCCAGGTGAGCGCTCA-T

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The NM_018941.4(CLN8):​c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 28)

Consequence

CLN8
NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.514
Variant links:
Genes affected
CLN8 (HGNC:2079): (CLN8 transmembrane ER and ERGIC protein) This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with a disorder characterized by progressive epilepsy with cognitive disabilities (EPMR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2017]
CLN8-AS1 (HGNC:55523): (CLN8 antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1126597 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.5, offset of 0 (no position change), new splice context is: cggGTgagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CLN8NM_018941.4 linkc.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG splice_region_variant Exon 1 of 3 ENST00000331222.6 NP_061764.2 Q9UBY8A0A024QZ57
CLN8NM_018941.4 linkc.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant Exon 1 of 3 ENST00000331222.6 NP_061764.2 Q9UBY8A0A024QZ57
CLN8NM_018941.4 linkc.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG non_coding_transcript_variant ENST00000331222.6 NP_061764.2 Q9UBY8A0A024QZ57

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CLN8ENST00000331222.6 linkc.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG splice_region_variant Exon 1 of 3 1 NM_018941.4 ENSP00000328182.4 Q9UBY8
CLN8ENST00000331222 linkc.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant Exon 1 of 3 1 NM_018941.4 ENSP00000328182.4 Q9UBY8
CLN8ENST00000331222.6 linkc.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG non_coding_transcript_variant 1 NM_018941.4 ENSP00000328182.4 Q9UBY8
KBTBD11-OT1ENST00000635855.1 linkn.-187_-167delCAGCCCAGGTGAGCGCTCAGG non_coding_transcript_exon_variant Exon 1 of 30 5 ENSP00000489726.1 A0A1B0GTJ5
KBTBD11-OT1ENST00000635855.1 linkn.-187_-167delCAGCCCAGGTGAGCGCTCAGG 5_prime_UTR_variant Exon 1 of 30 5 ENSP00000489726.1 A0A1B0GTJ5
KBTBD11-OT1ENST00000635855.1 linkn.-189_-169delGGCAGCCCAGGTGAGCGCTCA upstream_gene_variant 5 ENSP00000489726.1 A0A1B0GTJ5

Frequencies

GnomAD3 genomes
Cov.:
28
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
28

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Neuronal ceroid lipofuscinosis 8 Uncertain:1
Jul 27, 2017
Counsyl
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554446821; hg19: chr8-1712041; API