rs1554446821
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong
The NM_018941.4(CLN8):c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CLN8 | NM_018941.4 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_region_variant | Exon 1 of 3 | ENST00000331222.6 | NP_061764.2 | ||
CLN8 | NM_018941.4 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 3 | ENST00000331222.6 | NP_061764.2 | ||
CLN8 | NM_018941.4 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript_variant | ENST00000331222.6 | NP_061764.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CLN8 | ENST00000331222.6 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_region_variant | Exon 1 of 3 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
KBTBD11-OT1 | ENST00000635855.1 | n.-187_-167delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript_exon_variant | Exon 1 of 30 | 5 | ENSP00000489726.1 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-187_-167delCAGCCCAGGTGAGCGCTCAGG | 5_prime_UTR_variant | Exon 1 of 30 | 5 | ENSP00000489726.1 | ||||
CLN8 | ENST00000331222.6 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 3 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
CLN8 | ENST00000331222.6 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript_variant | 1 | NM_018941.4 | ENSP00000328182.4 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-189_-169delGGCAGCCCAGGTGAGCGCTCA | upstream_gene_variant | 5 | ENSP00000489726.1 |
Frequencies
GnomAD3 genomes Cov.: 28
GnomAD4 genome Cov.: 28
ClinVar
Submissions by phenotype
Neuronal ceroid lipofuscinosis 8 Uncertain:1
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at