rs1554446821
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong
The NM_018941.4(CLN8):c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018941.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CLN8 | MANE Select | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_region | Exon 1 of 3 | NP_061764.2 | ||||
| CLN8 | MANE Select | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_donor splice_region 5_prime_UTR intron | Exon 1 of 3 | NP_061764.2 | ||||
| CLN8 | MANE Select | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript | N/A | NP_061764.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CLN8 | TSL:1 MANE Select | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_region | Exon 1 of 3 | ENSP00000328182.4 | Q9UBY8 | |||
| CLN8 | TSL:1 MANE Select | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_donor splice_region 5_prime_UTR intron | Exon 1 of 3 | ENSP00000328182.4 | Q9UBY8 | |||
| CLN8 | TSL:1 MANE Select | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript | N/A | ENSP00000328182.4 | Q9UBY8 |
Frequencies
GnomAD3 genomes Cov.: 28
GnomAD4 genome Cov.: 28
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at