rs1554446821
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2
The NM_018941.4(CLN8):c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 28)
Consequence
CLN8
NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.514
Genes affected
CLN8 (HGNC:2079): (CLN8 transmembrane ER and ERGIC protein) This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with a disorder characterized by progressive epilepsy with cognitive disabilities (EPMR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1126597 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.5, offset of 0 (no position change), new splice context is: cggGTgagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CLN8 | NM_018941.4 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_region_variant | Exon 1 of 3 | ENST00000331222.6 | NP_061764.2 | ||
CLN8 | NM_018941.4 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 3 | ENST00000331222.6 | NP_061764.2 | ||
CLN8 | NM_018941.4 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript_variant | ENST00000331222.6 | NP_061764.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CLN8 | ENST00000331222.6 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_region_variant | Exon 1 of 3 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
CLN8 | ENST00000331222 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 3 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
CLN8 | ENST00000331222.6 | c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript_variant | 1 | NM_018941.4 | ENSP00000328182.4 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-187_-167delCAGCCCAGGTGAGCGCTCAGG | non_coding_transcript_exon_variant | Exon 1 of 30 | 5 | ENSP00000489726.1 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-187_-167delCAGCCCAGGTGAGCGCTCAGG | 5_prime_UTR_variant | Exon 1 of 30 | 5 | ENSP00000489726.1 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-189_-169delGGCAGCCCAGGTGAGCGCTCA | upstream_gene_variant | 5 | ENSP00000489726.1 |
Frequencies
GnomAD3 genomes Cov.: 28
GnomAD3 genomes
Cov.:
28
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 28
GnomAD4 genome
Cov.:
28
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Neuronal ceroid lipofuscinosis 8 Uncertain:1
Jul 27, 2017
Counsyl
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at