NM_018941.4:c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG

Variant names:

• chr8-1763875-TGGCAGCCCAGGTGAGCGCTCA-T
• rs1554446821
• NM_018941.4:c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_018941.4(CLN8):​c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 28)
• Consequence: CLN8 NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.514

Genes affected

CLN8 (HGNC:2079): (CLN8 transmembrane ER and ERGIC protein) This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with a disorder characterized by progressive epilepsy with cognitive disabilities (EPMR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2017]

KBTBD11-OT1 (HGNC:):

CLN8-AS1 (HGNC:55523): (CLN8 antisense RNA 1)

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1126597 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.5, offset of 0 (no position change), new splice context is: cggGTgagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CLN8	NM_018941.4	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_region_variant	Exon 1 of 3	ENST00000331222.6	NP_061764.2
CLN8	NM_018941.4	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 3	ENST00000331222.6	NP_061764.2
CLN8	NM_018941.4	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		non_coding_transcript_variant		ENST00000331222.6	NP_061764.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CLN8	ENST00000331222.6	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_region_variant	Exon 1 of 3	1	NM_018941.4	ENSP00000328182.4
CLN8	ENST00000331222	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 3	1	NM_018941.4	ENSP00000328182.4
CLN8	ENST00000331222.6	c.-131_-124+13delCAGCCCAGGTGAGCGCTCAGG		non_coding_transcript_variant		1	NM_018941.4	ENSP00000328182.4
KBTBD11-OT1	ENST00000635855.1	n.-187_-167delCAGCCCAGGTGAGCGCTCAGG		non_coding_transcript_exon_variant	Exon 1 of 30	5		ENSP00000489726.1
KBTBD11-OT1	ENST00000635855.1	n.-187_-167delCAGCCCAGGTGAGCGCTCAGG		5_prime_UTR_variant	Exon 1 of 30	5		ENSP00000489726.1
KBTBD11-OT1	ENST00000635855.1	n.-189_-169delGGCAGCCCAGGTGAGCGCTCA		upstream_gene_variant		5		ENSP00000489726.1

Frequencies

GnomAD3 genomes Cov.: 28

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 28

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Neuronal ceroid lipofuscinosis 8 Uncertain:1

Jul 27, 2017

Counsyl

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554446821; hg19: chr8-1712041;