ENST00000508624.5:n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3PP5_Moderate
The ENST00000508624.5(APC):n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT variant causes a splice region, non coding transcript exon change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
ENST00000508624.5 splice_region, non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- classic or attenuated familial adenomatous polyposisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- desmoid tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- familial adenomatous polyposis 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- gastric adenocarcinoma and proximal polyposis of the stomachInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- APC-related attenuated familial adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Turcot syndrome with polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cenani-Lenz syndactyly syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000508624.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | NM_000038.6 | MANE Select | c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | NP_000029.2 | ||
| APC | NM_001407446.1 | c.1614_1632+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe538MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | NP_001394375.1 | |||
| APC | NM_001354896.2 | c.1584_1602+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe528MetfsTer17 | frameshift splice_donor splice_region intron | Exon 13 of 17 | NP_001341825.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | ENST00000508624.5 | TSL:1 | n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | splice_region non_coding_transcript_exon | Exon 13 of 17 | ENSP00000424265.1 | |||
| APC | ENST00000257430.9 | TSL:5 MANE Select | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | ENSP00000257430.4 | ||
| APC | ENST00000508376.6 | TSL:1 | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 13 of 17 | ENSP00000427089.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Familial adenomatous polyposis 1 Pathogenic:1
This sequence change affects donor splice site in intron 12 of the APC gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with a APC-related disease. In summary, donor and acceptor splice site variants are typically truncating (PMID: 16199547), and truncating variants in APC are known to be pathogenic (PMID: 20685668, 17963004). However, without additional functional and/or genetic data, this variant has been classified as Likely Pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at