rs1554081752
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000038.6(APC):c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT(p.Phe510MetfsTer17) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. F510F) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene APC is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000038.6 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- classic or attenuated familial adenomatous polyposisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- desmoid tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- familial adenomatous polyposis 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- gastric adenocarcinoma and proximal polyposis of the stomachInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- APC-related attenuated familial adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Turcot syndrome with polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cenani-Lenz syndactyly syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000038.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | MANE Select | c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | NP_000029.2 | |||
| APC | c.1614_1632+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe538MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | NP_001394375.1 | ||||
| APC | c.1584_1602+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe528MetfsTer17 | frameshift splice_donor splice_region intron | Exon 13 of 17 | NP_001341825.1 | R4GMU6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | TSL:5 MANE Select | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | ENSP00000257430.4 | P25054-1 | ||
| APC | TSL:1 | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 13 of 17 | ENSP00000427089.2 | P25054-1 | ||
| APC | TSL:1 | n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | splice_region non_coding_transcript_exon | Exon 13 of 17 | ENSP00000424265.1 | E7EMH9 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at