rs1554081752

Variant names:

• chr5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C
• rs1554081752
• ENST00000508624.5:n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3 PP5_Moderate

The ENST00000508624.5(APC):​n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT variant causes a splice region, non coding transcript exon change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: APC ENST00000508624.5 splice_region, non_coding_transcript_exon
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

APC Gene-Disease associations (from GenCC):

• classic or attenuated familial adenomatous polyposis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• desmoid tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• familial adenomatous polyposis 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• gastric adenocarcinoma and proximal polyposis of the stomach

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• APC-related attenuated familial adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Turcot syndrome with polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cenani-Lenz syndactyly syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000258864 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C is Pathogenic according to our data. Variant chr5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 469710.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
APC	NM_000038.6	c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT	p.Phe510MetfsTer17	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 12 of 16	ENST00000257430.9	NP_000029.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
APC	ENST00000257430.9	c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT	p.Phe510MetfsTer17	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 12 of 16	5	NM_000038.6	ENSP00000257430.4
ENSG00000258864	ENST00000520401.1	n.12_33+7delTTTTGGAGATGTAGCCAACAAGGTATGTT		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 1 of 8	3		ENSP00000454861.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial adenomatous polyposis 1 Pathogenic:1

Jan 13, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects donor splice site in intron 12 of the APC gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with a APC-related disease. In summary, donor and acceptor splice site variants are typically truncating (PMID: 16199547), and truncating variants in APC are known to be pathogenic (PMID: 20685668, 17963004). However, without additional functional and/or genetic data, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554081752; hg19: chr5-112162922;