ENST00000620057.4:c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The ENST00000620057(BARD1):c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG variant causes a splice donor, splice region, 3 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
ENST00000620057 splice_donor, splice_region, 3_prime_UTR, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial cancer of breast Pathogenic:2
This variant has not been reported in the literature in individuals with BARD1-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change deletes 25 nucleotides at the exon 7 and intron 7 junction of the BARD1 gene and affects a donor splice site. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at