ENST00000620057.4:c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The ENST00000620057(BARD1):​c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG variant causes a splice donor, splice region, 3 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

BARD1
ENST00000620057 splice_donor, splice_region, 3_prime_UTR, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 1.96
Variant links:
Genes affected
BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, Cryptic splice site detected, with MaxEntScore 3.9, offset of -40, new splice context is: aaaGTatga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T is Pathogenic according to our data. Variant chr2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 530138.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BARD1NM_000465.4 linkc.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG p.Val559fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 7 of 11 ENST00000260947.9 NP_000456.2 Q99728-1A0AVN2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BARD1ENST00000260947.9 linkc.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG p.Val559fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 7 of 11 1 NM_000465.4 ENSP00000260947.4 Q99728-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Familial cancer of breast Pathogenic:2
Jun 04, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant has not been reported in the literature in individuals with BARD1-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change deletes 25 nucleotides at the exon 7 and intron 7 junction of the BARD1 gene and affects a donor splice site. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

May 23, 2023
Myriad Genetics, Inc.
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553616339; hg19: chr2-215617147; API