ENST00000620057.4:c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong
The ENST00000620057.4(BARD1):c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG variant causes a splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
ENST00000620057.4 splice_region
Scores
Clinical Significance
Conservation
Publications
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
- familial ovarian cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
- hereditary nonpolyposis colon cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000620057.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | NM_000465.4 | MANE Select | c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val559fs | frameshift splice_donor splice_region intron | Exon 7 of 11 | NP_000456.2 | ||
| BARD1 | NM_001282543.2 | c.1619_1620+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val540fs | frameshift splice_donor splice_region intron | Exon 6 of 10 | NP_001269472.1 | |||
| BARD1 | NM_001282545.2 | c.323_324+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val108fs | frameshift splice_donor splice_region intron | Exon 3 of 7 | NP_001269474.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | ENST00000620057.4 | TSL:1 | c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG | splice_region | Exon 6 of 10 | ENSP00000481988.1 | |||
| BARD1 | ENST00000260947.9 | TSL:1 MANE Select | c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val559fs | frameshift splice_donor splice_region intron | Exon 7 of 11 | ENSP00000260947.4 | ||
| BARD1 | ENST00000617164.5 | TSL:1 | c.1619_1620+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val540fs | frameshift splice_donor splice_region intron | Exon 6 of 10 | ENSP00000480470.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial cancer of breast Pathogenic:2
This variant has not been reported in the literature in individuals with BARD1-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change deletes 25 nucleotides at the exon 7 and intron 7 junction of the BARD1 gene and affects a donor splice site. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.
This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at