NM_000038.6:c.3928_3947delAAGATTGGAACTAGGTCAGC
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000038.6(APC):c.3928_3947delAAGATTGGAACTAGGTCAGC(p.Lys1310fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. K1310K) has been classified as Likely benign.
Frequency
Consequence
NM_000038.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- classic or attenuated familial adenomatous polyposisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- desmoid tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- familial adenomatous polyposis 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- gastric adenocarcinoma and proximal polyposis of the stomachInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- APC-related attenuated familial adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Turcot syndrome with polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cenani-Lenz syndactyly syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000038.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | NM_000038.6 | MANE Select | c.3928_3947delAAGATTGGAACTAGGTCAGC | p.Lys1310fs | frameshift | Exon 16 of 16 | NP_000029.2 | ||
| APC | NM_001407446.1 | c.4012_4031delAAGATTGGAACTAGGTCAGC | p.Lys1338fs | frameshift | Exon 16 of 16 | NP_001394375.1 | |||
| APC | NM_001354896.2 | c.3982_4001delAAGATTGGAACTAGGTCAGC | p.Lys1328fs | frameshift | Exon 17 of 17 | NP_001341825.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | ENST00000257430.9 | TSL:5 MANE Select | c.3928_3947delAAGATTGGAACTAGGTCAGC | p.Lys1310fs | frameshift | Exon 16 of 16 | ENSP00000257430.4 | ||
| APC | ENST00000508376.6 | TSL:1 | c.3928_3947delAAGATTGGAACTAGGTCAGC | p.Lys1310fs | frameshift | Exon 17 of 17 | ENSP00000427089.2 | ||
| APC | ENST00000502371.3 | TSL:1 | n.*2126_*2145delAAGATTGGAACTAGGTCAGC | non_coding_transcript_exon | Exon 12 of 12 | ENSP00000484935.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at