chr5-112839521-AAAGATTGGAACTAGGTCAGC-A

Variant names:

• chr5-112839521-AAAGATTGGAACTAGGTCAGC-A
• rs1057519844
• NM_000038.6:c.3928_3947delAAGATTGGAACTAGGTCAGC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_000038.6(APC):​c.3928_3947delAAGATTGGAACTAGGTCAGC​(p.Lys1310fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: APC NM_000038.6 frameshift
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.01

Genes affected

APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

ENSG00000258864 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 95 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
APC	NM_000038.6	c.3928_3947delAAGATTGGAACTAGGTCAGC	p.Lys1310fs	frameshift_variant	Exon 16 of 16	ENST00000257430.9	NP_000029.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
APC	ENST00000257430.9	c.3928_3947delAAGATTGGAACTAGGTCAGC	p.Lys1310fs	frameshift_variant	Exon 16 of 16	5	NM_000038.6	ENSP00000257430.4
ENSG00000258864	ENST00000520401.1	n.228+10550_228+10569delAAGATTGGAACTAGGTCAGC		intron_variant	Intron 3 of 7	3		ENSP00000454861.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Neoplasm Pathogenic:1

Jul 14, 2015

Database of Curated Mutations (DoCM)

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1057519844; hg19: chr5-112175218;