NM_000138.5:c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA

Variant names:

• chr15-48411220-CGATCAAGTATCTGTTGTGATTCGT-TC
• rs397515862
• NM_000138.5:c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP2

The NM_000138.5(FBN1):​c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA​(p.Thr2788GlufsTer5) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T2788T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: FBN1 NM_000138.5 frameshift, missense
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.30
• Publications: 1 publications found

Genes affected

FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]

FBN1 Gene-Disease associations (from GenCC):

• familial thoracic aortic aneurysm and aortic dissection

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Marfan syndrome

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P, PanelApp Australia, Orphanet, Ambry Genetics
• Acromicric dysplasia

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
• progeroid and marfanoid aspect-lipodystrophy syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
• stiff skin syndrome

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• Weill-Marchesani syndrome 2, dominant

  Inheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• geleophysic dysplasia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated ectopia lentis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• neonatal Marfan syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Weill-Marchesani syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• ectopia lentis 1, isolated, autosomal dominant

  Inheritance: AD Classification: LIMITED Submitted by: G2P
• Shprintzen-Goldberg syndrome

  Inheritance: AD, Unknown Classification: LIMITED, NO_KNOWN Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 59 pathogenic variants in the truncated region.
• PP2: Missense variant in the FBN1 gene, where missense mutations are typically associated with disease (based on misZ statistic). The gene has 1311 curated pathogenic missense variants (we use a threshold of 10). The gene has 112 curated benign missense variants. Gene score misZ: 5.0644 (above the threshold of 3.09). Trascript score misZ: 8.1787 (above the threshold of 3.09). GenCC associations: The gene is linked to Marfan syndrome, Weill-Marchesani syndrome 2, dominant, progeroid and marfanoid aspect-lipodystrophy syndrome, geleophysic dysplasia, Shprintzen-Goldberg syndrome, stiff skin syndrome, familial thoracic aortic aneurysm and aortic dissection, isolated ectopia lentis, ectopia lentis 1, isolated, autosomal dominant, Acromicric dysplasia, neonatal Marfan syndrome, Weill-Marchesani syndrome.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FBN1	NM_000138.5	c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA	p.Thr2788GlufsTer5	frameshift_variant, missense_variant	Exon 66 of 66	ENST00000316623.10	NP_000129.3
FBN1	NM_001406716.1	c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA	p.Thr2788GlufsTer5	frameshift_variant, missense_variant	Exon 65 of 65		NP_001393645.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FBN1	ENST00000316623.10	c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA	p.Thr2788GlufsTer5	frameshift_variant, missense_variant	Exon 66 of 66	1	NM_000138.5	ENSP00000325527.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Sep 26, 2011

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Thr2788fs variant has not been reported in the literature nor identified by our laboratory. This variant is predicted to cause a frameshift which alters th e protein's amino acid sequence beginning at codon 2788 and resulting in a prema ture stop codon five amino acids downstream. This alteration is predicted to re sult in a protein truncated by approximately 79 amino acids (less than 3% of the total length of the FBN1 protein) since the premature stop codon is likely not sensitive to nonsense-mediated decay because it occurs in the terminal most exon . It is possible that this variant may impact essential amino acids in this dow nstream part of the protein. However, the true impact of this variant on the pro tein and its function remains unclear. In the absence of additional information , such as control data, functional analyses, or segregation studies, the clinica l significance of this variant cannot be determined at this time. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397515862; hg19: chr15-48703417;