chr15-48411220-CGATCAAGTATCTGTTGTGATTCGT-TC

Position:

• chr15-48411220-CGATCAAGTATCTGTTGTGATTCGT-TC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_Moderate PM2 PP2

The NM_000138.5(FBN1):​c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA​(p.Thr2788fs) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: FBN1 NM_000138.5 frameshift, missense
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.30

Genes affected

FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]

FBN1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0295 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP2: Missense variant in gene, where missense usually causes diseases (based on misZ statistic), FBN1. . Gene score misZ 5.0644 (greater than the threshold 3.09). Trascript score misZ 8.1787 (greater than threshold 3.09). GenCC has associacion of gene with MASS syndrome, Weill-Marchesani syndrome, geleophysic dysplasia, Shprintzen-Goldberg syndrome, Acromicric dysplasia, familial thoracic aortic aneurysm and aortic dissection, progeroid and marfanoid aspect-lipodystrophy syndrome, ectopia lentis 1, isolated, autosomal dominant, Marfan syndrome, Weill-Marchesani syndrome 2, dominant, isolated ectopia lentis, neonatal Marfan syndrome, stiff skin syndrome.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FBN1	NM_000138.5	c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA	p.Thr2788fs	frameshift_variant, missense_variant	66/66	ENST00000316623.10	NP_000129.3
FBN1	NM_001406716.1	c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA	p.Thr2788fs	frameshift_variant, missense_variant	65/65		NP_001393645.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FBN1	ENST00000316623.10	c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA	p.Thr2788fs	frameshift_variant, missense_variant	66/66	1	NM_000138.5	ENSP00000325527.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Sep 26, 2011

The Thr2788fs variant has not been reported in the literature nor identified by our laboratory. This variant is predicted to cause a frameshift which alters th e protein's amino acid sequence beginning at codon 2788 and resulting in a prema ture stop codon five amino acids downstream. This alteration is predicted to re sult in a protein truncated by approximately 79 amino acids (less than 3% of the total length of the FBN1 protein) since the premature stop codon is likely not sensitive to nonsense-mediated decay because it occurs in the terminal most exon . It is possible that this variant may impact essential amino acids in this dow nstream part of the protein. However, the true impact of this variant on the pro tein and its function remains unclear. In the absence of additional information , such as control data, functional analyses, or segregation studies, the clinica l significance of this variant cannot be determined at this time. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397515862; hg19: chr15-48703417;