chr15-48411220-CGATCAAGTATCTGTTGTGATTCGT-TC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP2

The NM_000138.5(FBN1):​c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA​(p.Thr2788GlufsTer5) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T2788T) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

FBN1
NM_000138.5 frameshift, missense

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.30

Publications

1 publications found
Variant links:
Genes affected
FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]
FBN1 Gene-Disease associations (from GenCC):
  • familial thoracic aortic aneurysm and aortic dissection
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • Marfan syndrome
    Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P, PanelApp Australia, Orphanet, Ambry Genetics
  • Acromicric dysplasia
    Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
  • progeroid and marfanoid aspect-lipodystrophy syndrome
    Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
  • stiff skin syndrome
    Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • Weill-Marchesani syndrome 2, dominant
    Inheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
  • geleophysic dysplasia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • isolated ectopia lentis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • neonatal Marfan syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Weill-Marchesani syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • ectopia lentis 1, isolated, autosomal dominant
    Inheritance: AD Classification: LIMITED Submitted by: G2P
  • Shprintzen-Goldberg syndrome
    Inheritance: AD, Unknown Classification: LIMITED, NO_KNOWN Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 59 pathogenic variants in the truncated region.
PP2
Missense variant in the FBN1 gene, where missense mutations are typically associated with disease (based on misZ statistic). The gene has 1311 curated pathogenic missense variants (we use a threshold of 10). The gene has 112 curated benign missense variants. Gene score misZ: 5.0644 (above the threshold of 3.09). Trascript score misZ: 8.1787 (above the threshold of 3.09). GenCC associations: The gene is linked to Marfan syndrome, Weill-Marchesani syndrome 2, dominant, progeroid and marfanoid aspect-lipodystrophy syndrome, geleophysic dysplasia, Shprintzen-Goldberg syndrome, stiff skin syndrome, familial thoracic aortic aneurysm and aortic dissection, isolated ectopia lentis, ectopia lentis 1, isolated, autosomal dominant, Acromicric dysplasia, neonatal Marfan syndrome, Weill-Marchesani syndrome.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
FBN1NM_000138.5 linkc.8362_8386delACGAATCACAACAGATACTTGATCGinsGA p.Thr2788GlufsTer5 frameshift_variant, missense_variant Exon 66 of 66 ENST00000316623.10 NP_000129.3
FBN1NM_001406716.1 linkc.8362_8386delACGAATCACAACAGATACTTGATCGinsGA p.Thr2788GlufsTer5 frameshift_variant, missense_variant Exon 65 of 65 NP_001393645.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
FBN1ENST00000316623.10 linkc.8362_8386delACGAATCACAACAGATACTTGATCGinsGA p.Thr2788GlufsTer5 frameshift_variant, missense_variant Exon 66 of 66 1 NM_000138.5 ENSP00000325527.5

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Sep 26, 2011
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The Thr2788fs variant has not been reported in the literature nor identified by our laboratory. This variant is predicted to cause a frameshift which alters th e protein's amino acid sequence beginning at codon 2788 and resulting in a prema ture stop codon five amino acids downstream. This alteration is predicted to re sult in a protein truncated by approximately 79 amino acids (less than 3% of the total length of the FBN1 protein) since the premature stop codon is likely not sensitive to nonsense-mediated decay because it occurs in the terminal most exon . It is possible that this variant may impact essential amino acids in this dow nstream part of the protein. However, the true impact of this variant on the pro tein and its function remains unclear. In the absence of additional information , such as control data, functional analyses, or segregation studies, the clinica l significance of this variant cannot be determined at this time.

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397515862; hg19: chr15-48703417; API