NM_000273.3:c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC

Variant names:

• chrX-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T
• rs1057518787
• NM_000273.3:c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000273.3(GPR143):​c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC​(p.Leu6GlyfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 24)
• Consequence: GPR143 NM_000273.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 8.82

Genes affected

GPR143 (HGNC:20145): (G protein-coupled receptor 143) This gene encodes a protein that binds to heterotrimeric G proteins and is targeted to melanosomes in pigment cells. This protein is thought to be involved in intracellular signal transduction mechanisms. Mutations in this gene cause ocular albinism type 1, also referred to as Nettleship-Falls type ocular albinism, a severe visual disorder. A related pseudogene has been identified on chromosome Y. [provided by RefSeq, Dec 2009]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 26 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T is Pathogenic according to our data. Variant chrX-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 373941.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GPR143	NM_000273.3	c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift_variant	Exon 1 of 9	ENST00000467482.6	NP_000264.2
GPR143	XM_005274541.4	c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift_variant	Exon 1 of 9		XP_005274598.1
GPR143	XM_024452388.2	c.-2-4980_-2-4956delGCGCCTAGGGACCTTCTGCTGCCCC		intron_variant	Intron 1 of 8		XP_024308156.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GPR143	ENST00000467482.6	c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift_variant	Exon 1 of 9	1	NM_000273.3	ENSP00000417161.1
GPR143	ENST00000447366.5	c.-2-4980_-2-4956delGCGCCTAGGGACCTTCTGCTGCCCC		intron_variant	Intron 1 of 7	3		ENSP00000390546.2
GPR143	ENST00000431126.1	c.-3+314_-3+338delGCGCCTAGGGACCTTCTGCTGCCCC		intron_variant	Intron 1 of 5	3		ENSP00000406138.1

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Ocular albinism, type I Pathogenic:1

Jul 27, 2022

Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PVS1 PM2 PM3_Supporting -

not provided Pathogenic:1

Sep 28, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 373941). This variant has not been reported in the literature in individuals affected with GPR143-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu6Glyfs*9) in the GPR143 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in GPR143 are known to be pathogenic (PMID: 15965158, 18978956, 19390656, 21541274, 26160353, 28211458). -

Nystagmus;C0078917:Ocular albinism;C1445953:Reduced eye contact Pathogenic:1

Dec 13, 2013

Centre for Mendelian Genomics, University Medical Centre Ljubljana

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1057518787; hg19: chrX-9733821;