rs1057518787

Variant names:

• chrX-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T
• rs1057518787
• NM_000273.3:c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000273.3(GPR143):​c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC​(p.Leu6GlyfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 24)
• Consequence: GPR143 NM_000273.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 8.82
• Publications: 1 publications found

Genes affected

GPR143 (HGNC:20145): (G protein-coupled receptor 143) This gene encodes a protein that binds to heterotrimeric G proteins and is targeted to melanosomes in pigment cells. This protein is thought to be involved in intracellular signal transduction mechanisms. Mutations in this gene cause ocular albinism type 1, also referred to as Nettleship-Falls type ocular albinism, a severe visual disorder. A related pseudogene has been identified on chromosome Y. [provided by RefSeq, Dec 2009]

GPR143 Gene-Disease associations (from GenCC):

• inherited retinal dystrophy

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• ocular albinism

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• nystagmus 6, congenital, X-linked

  Inheritance: XL Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• X-linked recessive ocular albinism

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 76 pathogenic variants in the truncated region.
• PP5: Variant X-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T is Pathogenic according to our data. Variant chrX-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 373941.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000273.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GPR143	NM_000273.3	MANE Select	c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift	Exon 1 of 9	NP_000264.2
	GPR143	NM_001440781.1		c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift	Exon 1 of 9	NP_001427710.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GPR143	ENST00000467482.6	TSL:1 MANE Select	c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift	Exon 1 of 9	ENSP00000417161.1
	GPR143	ENST00000929114.1		c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift	Exon 1 of 10	ENSP00000599173.1
	GPR143	ENST00000929113.1		c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC	p.Leu6GlyfsTer9	frameshift	Exon 1 of 9	ENSP00000599172.1

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)
1	-	-	Nystagmus;C0078917:Ocular albinism;C1445953:Reduced eye contact (1)
1	-	-	Ocular albinism, type I (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1057518787; hg19: chrX-9733821;