chrX-9765781-TGGGGCAGCAGAAGGTCCCTAGGCGC-T
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000273.3(GPR143):c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC(p.Leu6GlyfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_000273.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- GPR143-related foveal hypoplasiaInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- ocular albinismInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- nystagmus 6, congenital, X-linkedInheritance: XL Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- X-linked recessive ocular albinismInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000273.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GPR143 | TSL:1 MANE Select | c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC | p.Leu6GlyfsTer9 | frameshift | Exon 1 of 9 | ENSP00000417161.1 | P51810 | ||
| GPR143 | c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC | p.Leu6GlyfsTer9 | frameshift | Exon 1 of 10 | ENSP00000599173.1 | ||||
| GPR143 | c.12_36delGCGCCTAGGGACCTTCTGCTGCCCC | p.Leu6GlyfsTer9 | frameshift | Exon 1 of 9 | ENSP00000599172.1 |
Frequencies
GnomAD3 genomes Cov.: 24
GnomAD4 genome Cov.: 24
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at