NM_000311.5:c.204_227delTCATGGTGGTGGCTGGGGGCAGCC

Variant names:

• chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCAT-C
• rs193922906
• NM_000311.5:c.204_227delTCATGGTGGTGGCTGGGGGCAGCC

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_000311.5(PRNP):​c.204_227delTCATGGTGGTGGCTGGGGGCAGCC​(p.His69_Pro76del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000735 in 1,613,168 control chromosomes in the GnomAD database, including 7 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. P68P) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.0012 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00068 (7 hom.)
• Consequence: PRNP NM_000311.5 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:6
• Conservation: PhyloP100: 3.05
• Publications: 2 publications found

Genes affected

PRNP (HGNC:9449): (prion protein (Kanno blood group)) The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

PRNP Gene-Disease associations (from GenCC):

• Gerstmann-Straussler-Scheinker syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp
• Huntington disease-like 1

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• inherited Creutzfeldt-Jakob disease

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• familial Alzheimer-like prion disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• fatal familial insomnia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• PrP systemic amyloidosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000311.5.
• BP6: Variant 20-4699379-CGGTGGTGGCTGGGGGCAGCCTCAT-C is Benign according to our data. Variant chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCAT-C is described in ClinVar as Likely_benign. ClinVar VariationId is 65494.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.00123 (186/151686) while in subpopulation EAS AF = 0.00351 (18/5134). AF 95% confidence interval is 0.00227. There are 0 homozygotes in GnomAd4. There are 86 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.
• BS2: High AC in GnomAd4 at 186 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000311.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRNP	NM_000311.5	MANE Select	c.204_227delTCATGGTGGTGGCTGGGGGCAGCC	p.His69_Pro76del	disruptive_inframe_deletion	Exon 2 of 2	NP_000302.1	Q53YK7
	PRNP	NM_001271561.3		c.115_138delTCATGGTGGTGGCTGGGGGCAGCC	p.Ser39_Ala46del	conservative_inframe_deletion	Exon 2 of 2	NP_001258490.1	F7VJQ1-1
	PRNP	NM_001080121.3		c.204_227delTCATGGTGGTGGCTGGGGGCAGCC	p.His69_Pro76del	disruptive_inframe_deletion	Exon 2 of 2	NP_001073590.1	P04156-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRNP	ENST00000379440.9	TSL:1 MANE Select	c.204_227delTCATGGTGGTGGCTGGGGGCAGCC	p.His69_Pro76del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000368752.4	P04156-1
	PRNP	ENST00000424424.2	TSL:1	c.204_227delTCATGGTGGTGGCTGGGGGCAGCC	p.His69_Pro76del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000411599.2	P04156-1
	PRNP	ENST00000430350.2	TSL:1	c.204_227delTCATGGTGGTGGCTGGGGGCAGCC	p.His69_Pro76del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000399376.2	P04156-1

Frequencies

GnomAD3 genomes AF: 0.00122 AC: 185 AN: 151568 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00107

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00190

Gnomad ASJ AF: 0.000289

Gnomad EAS AF: 0.00350

Gnomad SAS AF: 0.00230

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00316

Gnomad NFE AF: 0.00118

Gnomad OTH AF: 0.000480

GnomAD2 exomes AF: 0.000528 AC: 131 AN: 248054 AF XY: 0.000541

Gnomad AFR exome AF: 0.000263

Gnomad AMR exome AF: 0.000955

Gnomad ASJ exome AF: 0.000100

Gnomad EAS exome AF: 0.00104

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000206

Gnomad OTH exome AF: 0.000661

GnomAD4 exome AF: 0.000684 AC: 999 AN: 1461482 Hom.: 7 AF XY: 0.000824 AC XY: 599 AN XY: 727070

African (AFR) AF: 0.000717 AC: 24 AN: 33478

American (AMR) AF: 0.00143 AC: 64 AN: 44710

Ashkenazi Jewish (ASJ) AF: 0.000383 AC: 10 AN: 26112

East Asian (EAS) AF: 0.00171 AC: 68 AN: 39698

South Asian (SAS) AF: 0.00365 AC: 315 AN: 86214

European-Finnish (FIN) AF: 0.000188 AC: 10 AN: 53304

Middle Eastern (MID) AF: 0.000884 AC: 5 AN: 5658

European-Non Finnish (NFE) AF: 0.000395 AC: 439 AN: 1111942

Other (OTH) AF: 0.00106 AC: 64 AN: 60366

GnomAD4 genome AF: 0.00123 AC: 186 AN: 151686 Hom.: 0 Cov.: 32 AF XY: 0.00116 AC XY: 86 AN XY: 74146

African (AFR) AF: 0.00111 AC: 46 AN: 41328

American (AMR) AF: 0.00190 AC: 29 AN: 15254

Ashkenazi Jewish (ASJ) AF: 0.000289 AC: 1 AN: 3460

East Asian (EAS) AF: 0.00351 AC: 18 AN: 5134

South Asian (SAS) AF: 0.00231 AC: 11 AN: 4770

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10546

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00118 AC: 80 AN: 67884

Other (OTH) AF: 0.000475 AC: 1 AN: 2104

Alfa AF: 0.000513 Hom.: 0

Asia WGS AF: 0.00491 AC: 17 AN: 3478

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	3	not provided (3)
-	-	1	Gerstmann-Straussler-Scheinker syndrome;C0206042:Fatal familial insomnia;C0751254:Inherited Creutzfeldt-Jakob disease;C1847650:Spongiform encephalopathy with neuropsychiatric features;C1855588:Kuru, susceptibility to;C1864112:Huntington disease-like 1 (1)
-	-	1	Huntington disease-like 1 (1)
-	-	1	Inherited prion disease (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1
Mutation Taster		=136/64	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922906; hg19: chr20-4680025; COSMIC: COSV109440055;