NM_000329.3:c.292_311delATCGTCATAACAGAATTTGG
Variant summary
Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PM2_SupportingPVS1PM3
This summary comes from the ClinGen Evidence Repository: NM_000329.2(RPE65):c.292_311del (p.Ile98Hisfs) is a deletion variant in exon 4 of 14 that causes a frameshift and introduces a premature stop after 26 codons. This frameshift is predicted to trigger nonsense mediated decay in a gene in which loss-of-function is an established mechanism of disease (PVS1). A number of affected patients have been reported harboring this variant, including at least 2 probands with early-onset severe retinal dystrophy who were homozygous for the variant (1 point, PMID:30870047, PM3). This variant has a Grpmax filtering allele frequency of 0.0001565 (10/34580) in the Latino / Admixed American population in gnomAD v2.1.1 (with no homozygotes). This allele frequency is lower than the ClinGen LCA/eoRD VCEP threshold (<0.0002) (PM2_Supporting). In summary, this variant meets the criteria to be classified as pathogenic for RPE65-related recessive retinopathy based on the ACMG/AMP criteria applied, as specified by the ClinGen LCA/eoRD VCEP: PVS1, PM3, and PM2_Supporting. (VCEP specifications version 1.0.0; date of approval 09/21/2023). LINK:https://erepo.genome.network/evrepo/ui/classification/CA226536/MONDO:0100368/120
Frequency
Consequence
NM_000329.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- retinitis pigmentosaInheritance: AD, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- Leber congenital amaurosis 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- RPE65-related recessive retinopathyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics
- RPE65-related dominant retinopathyInheritance: AD Classification: STRONG Submitted by: ClinGen
- retinitis pigmentosa 20Inheritance: AR, AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- Leber congenital amaurosisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- severe early-childhood-onset retinal dystrophyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- retinitis pigmentosa 87 with choroidal involvementInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 11 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000131 AC: 20AN: 152180Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000438 AC: 11AN: 251352 AF XY: 0.0000515 show subpopulations
GnomAD4 exome AF: 0.00000821 AC: 12AN: 1461864Hom.: 0 AF XY: 0.00000963 AC XY: 7AN XY: 727232 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000131 AC: 20AN: 152180Hom.: 0 Cov.: 32 AF XY: 0.000188 AC XY: 14AN XY: 74356 show subpopulations
ClinVar
Submissions by phenotype
Leber congenital amaurosis Pathogenic:2
- -
- -
Leber congenital amaurosis 2 Pathogenic:2
- -
- -
not provided Pathogenic:1Other:1
- -
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 32865313, 31589614, 30870047, 10766140, 28181551) -
RPE65-related recessive retinopathy Pathogenic:1
NM_000329.2(RPE65):c.292_311del (p.Ile98Hisfs) is a deletion variant in exon 4 of 14 that causes a frameshift and introduces a premature stop after 26 codons. This frameshift is predicted to trigger nonsense mediated decay in a gene in which loss-of-function is an established mechanism of disease (PVS1). A number of affected patients have been reported harboring this variant, including at least 2 probands with early-onset severe retinal dystrophy who were homozygous for the variant (1 point, PMID: 30870047, PM3). This variant has a Grpmax filtering allele frequency of 0.0001565 (10/34580) in the Latino / Admixed American population in gnomAD v2.1.1 (with no homozygotes). This allele frequency is lower than the ClinGen LCA/eoRD VCEP threshold (<0.0002) (PM2_Supporting). In summary, this variant meets the criteria to be classified as pathogenic for RPE65-related recessive retinopathy based on the ACMG/AMP criteria applied, as specified by the ClinGen LCA/eoRD VCEP: PVS1, PM3, and PM2_Supporting. (VCEP specifications version 1.0.0; date of approval 09/21/2023). -
Leber congenital amaurosis 2;C3151086:Retinitis pigmentosa 20 Pathogenic:1
This sequence change creates a premature translational stop signal (p.Ile98Hisfs*26) in the RPE65 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RPE65 are known to be pathogenic (PMID: 9326941, 9501220, 9843205, 18632300). This variant is present in population databases (rs767212885, gnomAD 0.03%). This premature translational stop signal has been observed in individuals with RPE65-related conditions (PMID: 10766140, 28181551). ClinVar contains an entry for this variant (Variation ID: 98860). For these reasons, this variant has been classified as Pathogenic. -
Leber congenital amaurosis 2;C3151086:Retinitis pigmentosa 20;C5231465:Retinitis pigmentosa 87 with choroidal involvement Pathogenic:1
- -
Retinitis pigmentosa 20 Pathogenic:1
The variant is observed at an extremely low frequency in the gnomAD v2.1.1 dataset (total allele frequency: 0.004%). Predicted Consequence/Location: Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant. The variant has been reported at least twice as pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000098860 /PMID: 10766140, 32347917, 35129589 /3billion dataset). Therefore, this variant is classified as Pathogenic according to the recommendation of ACMG/AMP guideline. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at