rs62642583

Variant names:

• chr1-68444817-GCCAAATTCTGTTATGACGAT-G
• rs62642583
• NM_000329.3:c.292_311delATCGTCATAACAGAATTTGG

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PM2_Supporting PVS1 PM3

This summary comes from the ClinGen Evidence Repository: NM_000329.2(RPE65):c.292_311del (p.Ile98Hisfs) is a deletion variant in exon 4 of 14 that causes a frameshift and introduces a premature stop after 26 codons. This frameshift is predicted to trigger nonsense mediated decay in a gene in which loss-of-function is an established mechanism of disease (PVS1). A number of affected patients have been reported harboring this variant, including at least 2 probands with early-onset severe retinal dystrophy who were homozygous for the variant (1 point, PMID:30870047, PM3). This variant has a Grpmax filtering allele frequency of 0.0001565 (10/34580) in the Latino / Admixed American population in gnomAD v2.1.1 (with no homozygotes). This allele frequency is lower than the ClinGen LCA/eoRD VCEP threshold (<0.0002) (PM2_Supporting). In summary, this variant meets the criteria to be classified as pathogenic for RPE65-related recessive retinopathy based on the ACMG/AMP criteria applied, as specified by the ClinGen LCA/eoRD VCEP: PVS1, PM3, and PM2_Supporting. (VCEP specifications version 1.0.0; date of approval 09/21/2023). LINK:https://erepo.genome.network/evrepo/ui/classification/CA226536/MONDO:0100368/120

• Frequency:
  • Genomes: 𝑓 0.00013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000082 (0 hom.)
• Consequence: RPE65 NM_000329.3 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:9 O:1
• Conservation: PhyloP100: 9.37
• Publications: 4 publications found

Genes affected

RPE65 (HGNC:10294): (retinoid isomerohydrolase RPE65) The protein encoded by this gene is a component of the vitamin A visual cycle of the retina which supplies the 11-cis retinal chromophore of the photoreceptors opsin visual pigments. It is a member of the carotenoid cleavage oxygenase superfamily. All members of this superfamily are non-heme iron oxygenases with a seven-bladed propeller fold and oxidatively cleave carotenoid carbon:carbon double bonds. However, the protein encoded by this gene has acquired a divergent function that involves the concerted O-alkyl ester cleavage of its all-trans retinyl ester substrate and all-trans to 11-cis double bond isomerization of the retinyl moiety. As such, it performs the essential enzymatic isomerization step in the synthesis of 11-cis retinal. Mutations in this gene are associated with early-onset severe blinding disorders such as Leber congenital. [provided by RefSeq, Oct 2017]

RPE65 Gene-Disease associations (from GenCC):

• Leber congenital amaurosis 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• retinitis pigmentosa

  Inheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• RPE65-related recessive retinopathy

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia, Ambry Genetics
• RPE65-related dominant retinopathy

  Inheritance: AD Classification: STRONG Submitted by: ClinGen, PanelApp Australia
• retinitis pigmentosa 20

  Inheritance: AR, AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• Leber congenital amaurosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• severe early-childhood-onset retinal dystrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• retinitis pigmentosa 87 with choroidal involvement

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

LOC124904198 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 11 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PM3: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000329.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RPE65	NM_000329.3	MANE Select	c.292_311delATCGTCATAACAGAATTTGG	p.Ile98HisfsTer26	frameshift	Exon 4 of 14	NP_000320.1	Q16518
	RPE65	NM_001406856.1		c.16_35delATCGTCATAACAGAATTTGG	p.Ile6HisfsTer26	frameshift	Exon 3 of 13	NP_001393785.1
	RPE65	NM_001406857.1		c.16_35delATCGTCATAACAGAATTTGG	p.Ile6HisfsTer26	frameshift	Exon 3 of 13	NP_001393786.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RPE65	ENST00000262340.6	TSL:1 MANE Select	c.292_311delATCGTCATAACAGAATTTGG	p.Ile98HisfsTer26	frameshift	Exon 4 of 14	ENSP00000262340.5	Q16518
	RPE65	ENST00000713936.1		n.*197_*216delATCGTCATAACAGAATTTGG		non_coding_transcript_exon	Exon 5 of 15	ENSP00000519233.1	A0AAQ5BH58
	RPE65	ENST00000713937.1		n.292_311delATCGTCATAACAGAATTTGG		non_coding_transcript_exon	Exon 4 of 13	ENSP00000519234.1	A0AAQ5BH46

Frequencies

GnomAD3 genomes AF: 0.000131 AC: 20 AN: 152180 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000438 AC: 11 AN: 251352 AF XY: 0.0000515

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000880

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000821 AC: 12 AN: 1461864 Hom.: 0 AF XY: 0.00000963 AC XY: 7 AN XY: 727232

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.000224 AC: 10 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53412

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1111998

Other (OTH) AF: 0.0000166 AC: 1 AN: 60394

GnomAD4 genome AF: 0.000131 AC: 20 AN: 152180 Hom.: 0 Cov.: 32 AF XY: 0.000188 AC XY: 14 AN XY: 74356

African (AFR) AF: 0.00 AC: 0 AN: 41438

American (AMR) AF: 0.00131 AC: 20 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5190

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68036

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.000117

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
2	-	-	Leber congenital amaurosis (2)
2	-	-	Leber congenital amaurosis 2 (2)
1	-	-	Leber congenital amaurosis 2;C3151086:Retinitis pigmentosa 20 (1)
1	-	-	Leber congenital amaurosis 2;C3151086:Retinitis pigmentosa 20;C5231465:Retinitis pigmentosa 87 with choroidal involvement (1)
1	-	-	not provided (2)
1	-	-	Retinitis pigmentosa 20 (1)
1	-	-	RPE65-related recessive retinopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.4
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs62642583; hg19: chr1-68910500;