NM_000465.4:c.1205C>A
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000465.4(BARD1):c.1205C>A(p.Ser402*) variant causes a stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,794 control chromosomes in the GnomAD database, with no homozygous occurrence. In-silico tool predicts a pathogenic outcome for this variant. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000465.4 stop_gained
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.00000797 AC: 2AN: 250994Hom.: 0 AF XY: 0.00000737 AC XY: 1AN XY: 135640
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461794Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1AN XY: 727188
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial cancer of breast Pathogenic:3
This variant is considered pathogenic. This variant creates a termination codon and is predicted to result in premature protein truncation. -
- -
This sequence change creates a premature translational stop signal (p.Ser402*) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). This variant is present in population databases (rs796666047, gnomAD 0.002%). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 490923). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. For these reasons, this variant has been classified as Pathogenic. -
Hereditary cancer-predisposing syndrome Pathogenic:2
The p.S402* pathogenic mutation (also known as c.1205C>A), located in coding exon 4 of the BARD1 gene, results from a C to A substitution at nucleotide position 1205. This changes the amino acid from a serine to a stop codon within coding exon 4. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
This variant changes 1 nucleotide in exon 4 of the BARD1 gene, creating a premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has been identified in 2/250994 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BARD1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -
Hereditary breast ovarian cancer syndrome Pathogenic:1
Variant summary: BARD1 c.1205C>A (p.Ser402X) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (eg. c.1690C>T (p.Gln564X), c.1921C>T (p.Arg641X), c.1935_1954dupTGAACAGGAAGAAAAGTATG (p.Glu652fsX69)). The variant allele was found at a frequency of 8.1e-06 in 245726 control chromosomes (gnomAD). To our knowledge, no occurrence of c.1205C>A in individuals affected with Hereditary Breast and Ovarian Cancer and no experimental evidence demonstrating its impact on protein function have been reported. One other clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation, and classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at