chr2-214780669-G-T

Position:

• chr2-214780669-G-T

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The ENST00000260947.9(BARD1):​c.1205C>A​(p.Ser402Ter) variant causes a stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,794 control chromosomes in the GnomAD database, with no homozygous occurrence. In-silico tool predicts a pathogenic outcome for this variant. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. S402S) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: BARD1 ENST00000260947.9 stop_gained
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 3.53

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-214780669-G-T is Pathogenic according to our data. Variant chr2-214780669-G-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 490923.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BARD1	NM_000465.4	c.1205C>A	p.Ser402Ter	stop_gained	4/11	ENST00000260947.9	NP_000456.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BARD1	ENST00000260947.9	c.1205C>A	p.Ser402Ter	stop_gained	4/11	1	NM_000465.4	ENSP00000260947	P2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000797 AC: 2 AN: 250994 Hom.: 0 AF XY: 0.00000737 AC XY: 1 AN XY: 135640

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000882

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461794 Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1 AN XY: 727188

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast Pathogenic:3

Likely pathogenic, criteria provided, single submitter	clinical testing	Baylor Genetics	Feb 07, 2023	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Mar 04, 2023	For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 490923). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. This variant is present in population databases (rs796666047, gnomAD 0.002%). This sequence change creates a premature translational stop signal (p.Ser402*) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). -
Pathogenic, criteria provided, single submitter	clinical testing	Myriad Genetics, Inc.	May 22, 2023	This variant is considered pathogenic. This variant creates a termination codon and is predicted to result in premature protein truncation. -

Hereditary cancer-predisposing syndrome Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Ambry Genetics	May 24, 2022	The p.S402* pathogenic mutation (also known as c.1205C>A), located in coding exon 4 of the BARD1 gene, results from a C to A substitution at nucleotide position 1205. This changes the amino acid from a serine to a stop codon within coding exon 4. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Pathogenic, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	May 14, 2020	This variant changes 1 nucleotide in exon 4 of the BARD1 gene, creating a premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has been identified in 2/250994 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BARD1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Hereditary breast ovarian cancer syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Jul 31, 2018

Variant summary: BARD1 c.1205C>A (p.Ser402X) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (eg. c.1690C>T (p.Gln564X), c.1921C>T (p.Arg641X), c.1935_1954dupTGAACAGGAAGAAAAGTATG (p.Glu652fsX69)). The variant allele was found at a frequency of 8.1e-06 in 245726 control chromosomes (gnomAD). To our knowledge, no occurrence of c.1205C>A in individuals affected with Hereditary Breast and Ovarian Cancer and no experimental evidence demonstrating its impact on protein function have been reported. One other clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation, and classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
BayesDel_addAF	Pathogenic	0.35	D
BayesDel_noAF	Pathogenic	0.28
CADD	Pathogenic	37
DANN	Uncertain	0.99
Eigen	Uncertain	0.22
Eigen_PC	Benign	-0.060
FATHMM_MKL	Benign	0.65	D
MutationTaster	Benign	1.0	A;A
Vest4		0.51
GERP RS		4.4

Splicing

Name	Calibrated prediction	Score	Prediction
SpliceAI score (max)		0.040		Details are displayed if max score is > 0.2

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs796666047; hg19: chr2-215645393;