NM_000540.3:c.14587_14607delTTCTACAACAAGAGCGAGGAT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5

The NM_000540.3(RYR1):​c.14587_14607delTTCTACAACAAGAGCGAGGAT​(p.Phe4863_Asp4869del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. F4863F) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 31)

Consequence

RYR1
NM_000540.3 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.31

Publications

2 publications found
Variant links:
Genes affected
RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
RYR1 Gene-Disease associations (from GenCC):
  • malignant hyperthermia, susceptibility to, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
  • congenital multicore myopathy with external ophthalmoplegia
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
  • RYR1-related myopathy
    Inheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
  • central core myopathy
    Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • King-Denborough syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • malignant hyperthermia of anesthesia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • autosomal recessive centronuclear myopathy
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • benign Samaritan congenital myopathy
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • congenital myopathy with myasthenic-like onset
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • lethal multiple pterygium syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

PM1
In a hotspot region, there are 8 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 11 uncertain in NM_000540.3
PM4
Nonframeshift variant in NON repetitive region in NM_000540.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 19-38580444-GTTCTACAACAAGAGCGAGGAT-G is Pathogenic according to our data. Variant chr19-38580444-GTTCTACAACAAGAGCGAGGAT-G is described in ClinVar as [Pathogenic]. Clinvar id is 12986.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RYR1NM_000540.3 linkc.14587_14607delTTCTACAACAAGAGCGAGGAT p.Phe4863_Asp4869del conservative_inframe_deletion Exon 101 of 106 ENST00000359596.8 NP_000531.2 P21817-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RYR1ENST00000359596.8 linkc.14587_14607delTTCTACAACAAGAGCGAGGAT p.Phe4863_Asp4869del conservative_inframe_deletion Exon 101 of 106 5 NM_000540.3 ENSP00000352608.2 P21817-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Central core myopathy Pathogenic:1
Feb 15, 2003
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs118192169; hg19: chr19-39071084; API