chr19-38580444-GTTCTACAACAAGAGCGAGGAT-G

Variant names:

• chr19-38580444-GTTCTACAACAAGAGCGAGGAT-G
• rs118192169
• NM_000540.3:c.14587_14607delTTCTACAACAAGAGCGAGGAT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000540.3(RYR1):​c.14587_14607delTTCTACAACAAGAGCGAGGAT​(p.Phe4863_Asp4869del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. F4863F) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: RYR1 NM_000540.3 conservative_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.31
• Publications: 2 publications found

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 Gene-Disease associations (from GenCC):

• malignant hyperthermia, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
• congenital multicore myopathy with external ophthalmoplegia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• RYR1-related myopathy

  Inheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
• central core myopathy

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• King-Denborough syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant hyperthermia of anesthesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• benign Samaritan congenital myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• congenital myopathy with myasthenic-like onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 8 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 11 uncertain in NM_000540.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000540.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 19-38580444-GTTCTACAACAAGAGCGAGGAT-G is Pathogenic according to our data. Variant chr19-38580444-GTTCTACAACAAGAGCGAGGAT-G is described in ClinVar as [Pathogenic]. Clinvar id is 12986.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RYR1	NM_000540.3	c.14587_14607delTTCTACAACAAGAGCGAGGAT	p.Phe4863_Asp4869del	conservative_inframe_deletion	Exon 101 of 106	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.14587_14607delTTCTACAACAAGAGCGAGGAT	p.Phe4863_Asp4869del	conservative_inframe_deletion	Exon 101 of 106	5	NM_000540.3	ENSP00000352608.2

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Central core myopathy Pathogenic:1

Feb 15, 2003

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs118192169; hg19: chr19-39071084;