NM_000548.5:c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_000548.5(TSC2):c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA(p.Gly1664_Thr1674delinsAla) variant causes a disruptive inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G1664G) has been classified as Likely benign.
Frequency
Consequence
NM_000548.5 disruptive_inframe_deletion, splice_region
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | MANE Select | c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA | p.Gly1664_Thr1674delinsAla | disruptive_inframe_deletion splice_region | Exon 39 of 42 | NP_000539.2 | P49815-1 | ||
| TSC2 | c.4988_5017delGCCAGTTCAACTTTGTCCACGTGATCGTCA | p.Gly1663_Thr1673delinsAla | disruptive_inframe_deletion splice_region | Exon 39 of 42 | NP_001393592.1 | A0A2R8Y6C9 | |||
| TSC2 | c.4922_4951delGCCAGTTCAACTTTGTCCACGTGATCGTCA | p.Gly1641_Thr1651delinsAla | disruptive_inframe_deletion splice_region | Exon 38 of 41 | NP_001107854.1 | P49815-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | TSL:5 MANE Select | c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA | p.Gly1664_Thr1674delinsAla | disruptive_inframe_deletion splice_region | Exon 39 of 42 | ENSP00000219476.3 | P49815-1 | ||
| TSC2 | TSL:1 | c.4922_4951delGCCAGTTCAACTTTGTCCACGTGATCGTCA | p.Gly1641_Thr1651delinsAla | disruptive_inframe_deletion splice_region | Exon 38 of 41 | ENSP00000344383.4 | P49815-4 | ||
| TSC2 | TSL:1 | c.4790_4819delGCCAGTTCAACTTTGTCCACGTGATCGTCA | p.Gly1597_Thr1607delinsAla | disruptive_inframe_deletion splice_region | Exon 37 of 40 | ENSP00000384468.2 | P49815-5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at