rs1555439653

Variant names:

• chr16-2087863-GGCCAGTTCAACTTTGTCCACGTGATCGTCA-G
• rs1555439653
• NM_000548.5:c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_000548.5(TSC2):​c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA​(p.Gly1664_Thr1674delinsAla) variant causes a disruptive inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G1664G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: TSC2 NM_000548.5 disruptive_inframe_deletion, splice_region
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.92
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 9 benign, 16 uncertain in NM_000548.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000548.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA	p.Gly1664_Thr1674delinsAla	disruptive_inframe_deletion, splice_region_variant	Exon 39 of 42	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA	p.Gly1664_Thr1674delinsAla	disruptive_inframe_deletion, splice_region_variant	Exon 39 of 42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Oct 03, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant, c.4991_5020del30, results in the deletion of 10 amino acids of the TSC2 protein (p.Gly1664_Thr1674delinsAla), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with TSC2-related disease. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555439653; hg19: chr16-2137864;