chr16-2087863-GGCCAGTTCAACTTTGTCCACGTGATCGTCA-G

Position:

• chr16-2087863-GGCCAGTTCAACTTTGTCCACGTGATCGTCA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1 PM2 PM4 PP3

The NM_000548.5(TSC2):​c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA​(p.Gly1664_Thr1674delinsAla) variant causes a disruptive inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TSC2 NM_000548.5 disruptive_inframe_deletion, splice_region
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.92

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM1: In a domain Rap-GAP (size 227) in uniprot entity TSC2_HUMAN there are 284 pathogenic changes around while only 47 benign (86%) in NM_000548.5
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000548.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TSC2	NM_000548.5	c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA	p.Gly1664_Thr1674delinsAla	disruptive_inframe_deletion, splice_region_variant	39/42	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.4991_5020delGCCAGTTCAACTTTGTCCACGTGATCGTCA	p.Gly1664_Thr1674delinsAla	disruptive_inframe_deletion, splice_region_variant	39/42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 03, 2017

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant has not been reported in the literature in individuals with TSC2-related disease. This variant is not present in population databases (ExAC no frequency). This variant, c.4991_5020del30, results in the deletion of 10 amino acids of the TSC2 protein (p.Gly1664_Thr1674delinsAla), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555439653; hg19: chr16-2137864;