NM_001018116.2:c.702_722delAAGGCAGTCAGGAGAGAGGCT
Variant summary
Our verdict is Benign. The variant received -9 ACMG points: 3P and 12B. PM4PP3BP6_Very_StrongBS2
The NM_001018116.2(CAVIN4):c.702_722delAAGGCAGTCAGGAGAGAGGCT(p.Arg235_Leu241del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00332 in 1,614,020 control chromosomes in the GnomAD database, including 11 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_001018116.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -9 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CAVIN4 | NM_001018116.2 | c.702_722delAAGGCAGTCAGGAGAGAGGCT | p.Arg235_Leu241del | disruptive_inframe_deletion | Exon 2 of 2 | ENST00000307584.6 | NP_001018126.1 | |
| CAVIN4 | XM_047423346.1 | c.678_698delAAGGCAGTCAGGAGAGAGGCT | p.Arg227_Leu233del | disruptive_inframe_deletion | Exon 3 of 3 | XP_047279302.1 | ||
| CAVIN4 | XM_047423347.1 | c.315_335delAAGGCAGTCAGGAGAGAGGCT | p.Arg106_Leu112del | disruptive_inframe_deletion | Exon 2 of 2 | XP_047279303.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00219 AC: 334AN: 152208Hom.: 1 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00263 AC: 660AN: 251226 AF XY: 0.00264 show subpopulations
GnomAD4 exome AF: 0.00344 AC: 5025AN: 1461694Hom.: 10 AF XY: 0.00333 AC XY: 2423AN XY: 727154 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00219 AC: 334AN: 152326Hom.: 1 Cov.: 32 AF XY: 0.00200 AC XY: 149AN XY: 74492 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:2
CAVIN4: BS2 -
This variant is associated with the following publications: (PMID: 21642240) -
not specified Benign:1
p.Leu248_Arg254del in exon 2 of MURC: This variant falls within a 7 amino acid r epeat (LRQSGER) and results in the removal of one repeat unit as compared to the reference sequence. Although it has been reported in three individuals with car diomyopathy (Rodriguez 2011), it is not expected to have clinical significance b ecause it has also been identified in 0.6% (369/66702) of European chromosomes b y the Exome Aggregation Consortium (ExAC, http://exac.broadinstitute.org). Moreo ver, this region lacks conservation across species, and >5 mammals show a loss o f a single repeat unit within this region. -
CAVIN4-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at