rs876657508

Variant names:

• chr9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A
• rs876657508
• NM_001018116.2:c.702_722delAAGGCAGTCAGGAGAGAGGCT

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 3P and 12B. PM4 PP3 BP6_Very_Strong BS2

The NM_001018116.2(CAVIN4):​c.702_722delAAGGCAGTCAGGAGAGAGGCT​(p.Arg235_Leu241del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00332 in 1,614,020 control chromosomes in the GnomAD database, including 11 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0022 (1 hom., cov: 32)
  • Exomes 𝑓: 0.0034 (10 hom.)
• Consequence: CAVIN4 NM_001018116.2 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 9.26

Genes affected

CAVIN4 (HGNC:33742): (caveolae associated protein 4) This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001018116.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• BP6: Variant 9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A is Benign according to our data. Variant chr9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A is described in ClinVar as [Likely_benign]. Clinvar id is 227559.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAdExome4 at 10 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CAVIN4	NM_001018116.2	c.702_722delAAGGCAGTCAGGAGAGAGGCT	p.Arg235_Leu241del	disruptive_inframe_deletion	Exon 2 of 2	ENST00000307584.6	NP_001018126.1
CAVIN4	XM_047423346.1	c.678_698delAAGGCAGTCAGGAGAGAGGCT	p.Arg227_Leu233del	disruptive_inframe_deletion	Exon 3 of 3		XP_047279302.1
CAVIN4	XM_047423347.1	c.315_335delAAGGCAGTCAGGAGAGAGGCT	p.Arg106_Leu112del	disruptive_inframe_deletion	Exon 2 of 2		XP_047279303.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CAVIN4	ENST00000307584.6	c.702_722delAAGGCAGTCAGGAGAGAGGCT	p.Arg235_Leu241del	disruptive_inframe_deletion	Exon 2 of 2	1	NM_001018116.2	ENSP00000418668.1

Frequencies

GnomAD3 genomes AF: 0.00219 AC: 334 AN: 152208 Hom.: 1 Cov.: 32

Gnomad AFR AF: 0.000675

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000851

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000829

Gnomad FIN AF: 0.00104

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00407

Gnomad OTH AF: 0.000478

GnomAD3 exomes AF: 0.00263 AC: 660 AN: 251226 Hom.: 2 AF XY: 0.00264 AC XY: 358 AN XY: 135766

Gnomad AFR exome AF: 0.000369

Gnomad AMR exome AF: 0.000694

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000915

Gnomad FIN exome AF: 0.00176

Gnomad NFE exome AF: 0.00486

Gnomad OTH exome AF: 0.00196

GnomAD4 exome AF: 0.00344 AC: 5025 AN: 1461694 Hom.: 10 AF XY: 0.00333 AC XY: 2423 AN XY: 727154

Gnomad4 AFR exome AF: 0.000568

Gnomad4 AMR exome AF: 0.000716

Gnomad4 ASJ exome AF: 0.0000383

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000916

Gnomad4 FIN exome AF: 0.00204

Gnomad4 NFE exome AF: 0.00409

Gnomad4 OTH exome AF: 0.00396

GnomAD4 genome AF: 0.00219 AC: 334 AN: 152326 Hom.: 1 Cov.: 32 AF XY: 0.00200 AC XY: 149 AN XY: 74492

Gnomad4 AFR AF: 0.000673

Gnomad4 AMR AF: 0.000850

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000830

Gnomad4 FIN AF: 0.00104

Gnomad4 NFE AF: 0.00407

Gnomad4 OTH AF: 0.000473

Alfa AF: 0.00237 Hom.: 0

EpiCase AF: 0.00338

EpiControl AF: 0.00338

ClinVar

Significance: Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Apr 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

CAVIN4: BS2 -

May 06, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 21642240) -

not specified Benign:1

Mar 21, 2015

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

p.Leu248_Arg254del in exon 2 of MURC: This variant falls within a 7 amino acid r epeat (LRQSGER) and results in the removal of one repeat unit as compared to the reference sequence. Although it has been reported in three individuals with car diomyopathy (Rodriguez 2011), it is not expected to have clinical significance b ecause it has also been identified in 0.6% (369/66702) of European chromosomes b y the Exome Aggregation Consortium (ExAC, http://exac.broadinstitute.org). Moreo ver, this region lacks conservation across species, and >5 mammals show a loss o f a single repeat unit within this region. -

CAVIN4-related disorder Benign:1

Jan 06, 2023

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs876657508; hg19: chr9-103348329;