chr9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A

Variant names:

• chr9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A
• rs876657508
• NM_001018116.2:c.702_722delAAGGCAGTCAGGAGAGAGGCT

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 3P and 12B. PM4 PP3 BP6_Very_Strong BS2

The NM_001018116.2(CAVIN4):​c.702_722delAAGGCAGTCAGGAGAGAGGCT​(p.Arg235_Leu241del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00332 in 1,614,020 control chromosomes in the GnomAD database, including 11 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0022 (1 hom., cov: 32)
  • Exomes 𝑓: 0.0034 (10 hom.)
• Consequence: CAVIN4 NM_001018116.2 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 9.26
• Publications: 0 publications found

Genes affected

CAVIN4 (HGNC:33742): (caveolae associated protein 4) This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001018116.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• BP6: Variant 9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A is Benign according to our data. Variant chr9-100586047-AGAGAGAGGCTAAGGCAGTCAG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 227559.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAdExome4 at 10 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001018116.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CAVIN4	NM_001018116.2	MANE Select	c.702_722delAAGGCAGTCAGGAGAGAGGCT	p.Arg235_Leu241del	disruptive_inframe_deletion	Exon 2 of 2	NP_001018126.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CAVIN4	ENST00000307584.6	TSL:1 MANE Select	c.702_722delAAGGCAGTCAGGAGAGAGGCT	p.Arg235_Leu241del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000418668.1
	CAVIN4	ENST00000956994.1		c.699_719delAAGGCAGTCAGGAGAGAGGCT	p.Arg234_Leu240del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000627053.1

Frequencies

GnomAD3 genomes AF: 0.00219 AC: 334 AN: 152208 Hom.: 1 Cov.: 32

Gnomad AFR AF: 0.000675

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000851

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000829

Gnomad FIN AF: 0.00104

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00407

Gnomad OTH AF: 0.000478

GnomAD2 exomes AF: 0.00263 AC: 660 AN: 251226 AF XY: 0.00264

Gnomad AFR exome AF: 0.000369

Gnomad AMR exome AF: 0.000694

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00176

Gnomad NFE exome AF: 0.00486

Gnomad OTH exome AF: 0.00196

GnomAD4 exome AF: 0.00344 AC: 5025 AN: 1461694 Hom.: 10 AF XY: 0.00333 AC XY: 2423 AN XY: 727154

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000568 AC: 19 AN: 33480

American (AMR) AF: 0.000716 AC: 32 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.0000383 AC: 1 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.000916 AC: 79 AN: 86254

European-Finnish (FIN) AF: 0.00204 AC: 109 AN: 53420

Middle Eastern (MID) AF: 0.000520 AC: 3 AN: 5768

European-Non Finnish (NFE) AF: 0.00409 AC: 4543 AN: 1111836

Other (OTH) AF: 0.00396 AC: 239 AN: 60384

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00219 AC: 334 AN: 152326 Hom.: 1 Cov.: 32 AF XY: 0.00200 AC XY: 149 AN XY: 74492

African (AFR) AF: 0.000673 AC: 28 AN: 41578

American (AMR) AF: 0.000850 AC: 13 AN: 15300

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5190

South Asian (SAS) AF: 0.000830 AC: 4 AN: 4822

European-Finnish (FIN) AF: 0.00104 AC: 11 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00407 AC: 277 AN: 68024

Other (OTH) AF: 0.000473 AC: 1 AN: 2116

Alfa AF: 0.00237 Hom.: 0

EpiCase AF: 0.00338

EpiControl AF: 0.00338

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	CAVIN4-related disorder (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=148/52	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876657508; hg19: chr9-103348329;