NM_001065.4:c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001065.4(TNFRSF1A):​c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC​(p.Leu196_Gly204del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

TNFRSF1A
NM_001065.4 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 0.998

Publications

3 publications found
Variant links:
Genes affected
TNFRSF1A (HGNC:11916): (TNF receptor superfamily member 1A) This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mutations in this gene underlie tumor necrosis factor receptor-associated periodic syndrome (TRAPS), characterized by fever, abdominal pain and other features. Mutations in this gene may also be associated with multiple sclerosis in human patients. [provided by RefSeq, Sep 2016]
TNFRSF1A Gene-Disease associations (from GenCC):
  • TNF receptor 1-associated periodic fever syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Laboratory for Molecular Medicine, Illumina

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_001065.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TNFRSF1ANM_001065.4 linkc.586_612delCTACCCCAGATTGAGAATGTTAAGGGC p.Leu196_Gly204del conservative_inframe_deletion Exon 6 of 10 ENST00000162749.7 NP_001056.1
TNFRSF1ANM_001346091.2 linkc.262_288delCTACCCCAGATTGAGAATGTTAAGGGC p.Leu88_Gly96del conservative_inframe_deletion Exon 5 of 9 NP_001333020.1
TNFRSF1ANM_001346092.2 linkc.127_153delCTACCCCAGATTGAGAATGTTAAGGGC p.Leu43_Gly51del conservative_inframe_deletion Exon 7 of 11 NP_001333021.1
TNFRSF1ANR_144351.2 linkn.814-181_814-155delCTACCCCAGATTGAGAATGTTAAGGGC intron_variant Intron 5 of 8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TNFRSF1AENST00000162749.7 linkc.586_612delCTACCCCAGATTGAGAATGTTAAGGGC p.Leu196_Gly204del conservative_inframe_deletion Exon 6 of 10 1 NM_001065.4 ENSP00000162749.2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

TNF receptor-associated periodic fever syndrome (TRAPS) Other:1
Unité médicale des maladies autoinflammatoires, CHRU Montpellier
Significance:not provided
Review Status:no classification provided
Collection Method:literature only

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.0
Mutation Taster
=33/167
disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs104895272; hg19: chr12-6440031; API