chr12-6330865-TGCCCTTAACATTCTCAATCTGGGGTAG-T
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001065.4(TNFRSF1A):c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC(p.Leu196_Gly204del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).
Frequency
Consequence
NM_001065.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- TNF receptor 1-associated periodic fever syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Illumina, Laboratory for Molecular Medicine, Ambry Genetics, PanelApp Australia, Orphanet, Labcorp Genetics (formerly Invitae), G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001065.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TNFRSF1A | MANE Select | c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC | p.Leu196_Gly204del | conservative_inframe_deletion | Exon 6 of 10 | NP_001056.1 | P19438-1 | ||
| TNFRSF1A | c.262_288delCTACCCCAGATTGAGAATGTTAAGGGC | p.Leu88_Gly96del | conservative_inframe_deletion | Exon 5 of 9 | NP_001333020.1 | P19438-2 | |||
| TNFRSF1A | c.127_153delCTACCCCAGATTGAGAATGTTAAGGGC | p.Leu43_Gly51del | conservative_inframe_deletion | Exon 7 of 11 | NP_001333021.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TNFRSF1A | TSL:1 MANE Select | c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC | p.Leu196_Gly204del | conservative_inframe_deletion | Exon 6 of 10 | ENSP00000162749.2 | P19438-1 | ||
| TNFRSF1A | TSL:1 | c.457_483delCTACCCCAGATTGAGAATGTTAAGGGC | p.Leu153_Gly161del | conservative_inframe_deletion | Exon 5 of 9 | ENSP00000438343.1 | F5H061 | ||
| TNFRSF1A | TSL:1 | n.1687_1713delCTACCCCAGATTGAGAATGTTAAGGGC | non_coding_transcript_exon | Exon 6 of 10 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at