NM_001367805.3:c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG

Variant names:

• chr15-69414535-T-TGGGGGCAGGCGTCTCCACTCA
• rs3830440
• NM_001367805.3:c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_001367805.3(KIF23):​c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0302 in 1,498,522 control chromosomes in the GnomAD database, including 2,348 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.077 (820 hom., cov: 32)
  • Exomes 𝑓: 0.025 (1528 hom.)
• Consequence: KIF23 NM_001367805.3 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.240
• Publications: 0 publications found

Genes affected

KIF23 (HGNC:6392): (kinesin family member 23) The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

KIF23-AS1 (HGNC:27075): (KIF23 and PAQR5 antisense RNA 1)

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 15-69414535-T-TGGGGGCAGGCGTCTCCACTCA is Benign according to our data. Variant chr15-69414535-T-TGGGGGCAGGCGTCTCCACTCA is described in ClinVar as Benign. ClinVar VariationId is 1239833.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.169 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001367805.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KIF23	NM_001367805.3	MANE Select	c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron	N/A	NP_001354734.1	A0A7I2V5Y5
	KIF23	NM_138555.4		c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron	N/A	NP_612565.1	Q02241-1
	KIF23	NM_001367804.2		c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron	N/A	NP_001354733.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KIF23	ENST00000679126.1	MANE Select	c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron	N/A	ENSP00000504770.1	A0A7I2V5Y5
	KIF23	ENST00000260363.9	TSL:1	c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron	N/A	ENSP00000260363.4	Q02241-1
	KIF23	ENST00000352331.8	TSL:1	c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron	N/A	ENSP00000304978.6	Q02241-2

Frequencies

GnomAD3 genomes AF: 0.0770 AC: 11716 AN: 152064 Hom.: 817 Cov.: 32

Gnomad AFR AF: 0.172

Gnomad AMI AF: 0.0241

Gnomad AMR AF: 0.107

Gnomad ASJ AF: 0.00634

Gnomad EAS AF: 0.176

Gnomad SAS AF: 0.0236

Gnomad FIN AF: 0.0432

Gnomad MID AF: 0.0510

Gnomad NFE AF: 0.0187

Gnomad OTH AF: 0.0641

GnomAD4 exome AF: 0.0249 AC: 33526 AN: 1346342 Hom.: 1528 Cov.: 27 AF XY: 0.0241 AC XY: 15921 AN XY: 661188

African (AFR) AF: 0.143 AC: 4010 AN: 28030

American (AMR) AF: 0.0852 AC: 2497 AN: 29296

Ashkenazi Jewish (ASJ) AF: 0.00446 AC: 104 AN: 23328

East Asian (EAS) AF: 0.173 AC: 5677 AN: 32882

South Asian (SAS) AF: 0.0166 AC: 1235 AN: 74424

European-Finnish (FIN) AF: 0.0373 AC: 1777 AN: 47648

Middle Eastern (MID) AF: 0.0223 AC: 88 AN: 3938

European-Non Finnish (NFE) AF: 0.0155 AC: 16292 AN: 1051466

Other (OTH) AF: 0.0334 AC: 1846 AN: 55330

GnomAD4 genome AF: 0.0771 AC: 11736 AN: 152180 Hom.: 820 Cov.: 32 AF XY: 0.0788 AC XY: 5866 AN XY: 74426

African (AFR) AF: 0.172 AC: 7153 AN: 41514

American (AMR) AF: 0.107 AC: 1634 AN: 15302

Ashkenazi Jewish (ASJ) AF: 0.00634 AC: 22 AN: 3468

East Asian (EAS) AF: 0.176 AC: 907 AN: 5140

South Asian (SAS) AF: 0.0238 AC: 115 AN: 4828

European-Finnish (FIN) AF: 0.0432 AC: 459 AN: 10618

Middle Eastern (MID) AF: 0.0479 AC: 14 AN: 292

European-Non Finnish (NFE) AF: 0.0188 AC: 1275 AN: 67994

Other (OTH) AF: 0.0639 AC: 135 AN: 2112

Alfa AF: 0.0494 Hom.: 35

Asia WGS AF: 0.0930 AC: 322 AN: 3478

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.24
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3830440; hg19: chr15-69706874;