chr15-69414535-T-TGGGGGCAGGCGTCTCCACTCA

Variant names:

• chr15-69414535-T-TGGGGGCAGGCGTCTCCACTCA
• rs3830440
• NM_001367805.3:c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_001367805.3(KIF23):​c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0302 in 1,498,522 control chromosomes in the GnomAD database, including 2,348 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.077 (820 hom., cov: 32)
  • Exomes 𝑓: 0.025 (1528 hom.)
• Consequence: KIF23 NM_001367805.3 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.240

Genes affected

KIF23 (HGNC:6392): (kinesin family member 23) The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

KIF23-AS1 (HGNC:27075): (KIF23 and PAQR5 antisense RNA 1)

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 15-69414535-T-TGGGGGCAGGCGTCTCCACTCA is Benign according to our data. Variant chr15-69414535-T-TGGGGGCAGGCGTCTCCACTCA is described in ClinVar as [Benign]. Clinvar id is 1239833.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.169 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KIF23	NM_001367805.3	c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron_variant	Intron 1 of 23	ENST00000679126.1	NP_001354734.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KIF23	ENST00000679126.1	c.11+62_11+82dupGGGCAGGCGTCTCCACTCAGG		intron_variant	Intron 1 of 23		NM_001367805.3	ENSP00000504770.1

Frequencies

GnomAD3 genomes AF: 0.0770 AC: 11716 AN: 152064 Hom.: 817 Cov.: 32

Gnomad AFR AF: 0.172

Gnomad AMI AF: 0.0241

Gnomad AMR AF: 0.107

Gnomad ASJ AF: 0.00634

Gnomad EAS AF: 0.176

Gnomad SAS AF: 0.0236

Gnomad FIN AF: 0.0432

Gnomad MID AF: 0.0510

Gnomad NFE AF: 0.0187

Gnomad OTH AF: 0.0641

GnomAD4 exome AF: 0.0249 AC: 33526 AN: 1346342 Hom.: 1528 Cov.: 27 AF XY: 0.0241 AC XY: 15921 AN XY: 661188

Gnomad4 AFR exome AF: 0.143 AC: 4010 AN: 28030

Gnomad4 AMR exome AF: 0.0852 AC: 2497 AN: 29296

Gnomad4 ASJ exome AF: 0.00446 AC: 104 AN: 23328

Gnomad4 EAS exome AF: 0.173 AC: 5677 AN: 32882

Gnomad4 SAS exome AF: 0.0166 AC: 1235 AN: 74424

Gnomad4 FIN exome AF: 0.0373 AC: 1777 AN: 47648

Gnomad4 NFE exome AF: 0.0155 AC: 16292 AN: 1051466

Gnomad4 Remaining exome AF: 0.0334 AC: 1846 AN: 55330

GnomAD4 genome AF: 0.0771 AC: 11736 AN: 152180 Hom.: 820 Cov.: 32 AF XY: 0.0788 AC XY: 5866 AN XY: 74426

Gnomad4 AFR AF: 0.172 AC: 0.172303 AN: 0.172303

Gnomad4 AMR AF: 0.107 AC: 0.106783 AN: 0.106783

Gnomad4 ASJ AF: 0.00634 AC: 0.00634371 AN: 0.00634371

Gnomad4 EAS AF: 0.176 AC: 0.176459 AN: 0.176459

Gnomad4 SAS AF: 0.0238 AC: 0.0238194 AN: 0.0238194

Gnomad4 FIN AF: 0.0432 AC: 0.0432285 AN: 0.0432285

Gnomad4 NFE AF: 0.0188 AC: 0.0187517 AN: 0.0187517

Gnomad4 OTH AF: 0.0639 AC: 0.0639205 AN: 0.0639205

Alfa AF: 0.0494 Hom.: 35

Asia WGS AF: 0.0930 AC: 322 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Oct 07, 2019

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3830440; hg19: chr15-69706874;