NM_002473.6:c.3195_3215dupCGAGCTCCAGGCCCAGATCGC

Variant names:

• chr22-36296899-C-CGCGATCTGGGCCTGGAGCTCG
• rs876661302
• NM_002473.6:c.3195_3215dupCGAGCTCCAGGCCCAGATCGC

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2 PP5_Moderate BP3

The NM_002473.6(MYH9):​c.3195_3215dupCGAGCTCCAGGCCCAGATCGC​(p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYH9 NM_002473.6 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.87

Genes affected

MYH9 (HGNC:7579): (myosin heavy chain 9) This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 22-36296899-C-CGCGATCTGGGCCTGGAGCTCG is Pathogenic according to our data. Variant chr22-36296899-C-CGCGATCTGGGCCTGGAGCTCG is described in ClinVar as [Pathogenic]. Clinvar id is 14085.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_002473.6

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYH9	NM_002473.6	c.3195_3215dupCGAGCTCCAGGCCCAGATCGC	p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla	disruptive_inframe_insertion	Exon 25 of 41	ENST00000216181.11	NP_002464.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYH9	ENST00000216181.11	c.3195_3215dupCGAGCTCCAGGCCCAGATCGC	p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla	disruptive_inframe_insertion	Exon 25 of 41	1	NM_002473.6	ENSP00000216181.6
MYH9	ENST00000685801.1	c.3258_3278dupCGAGCTCCAGGCCCAGATCGC	p.Ala1093_Glu1094insGluLeuGlnAlaGlnIleAla	disruptive_inframe_insertion	Exon 26 of 42			ENSP00000510688.1
MYH9	ENST00000459960.1	n.404_424dupCGAGCTCCAGGCCCAGATCGC		non_coding_transcript_exon_variant	Exon 1 of 2	2
MYH9	ENST00000691109.1	n.3490_3510dupCGAGCTCCAGGCCCAGATCGC		non_coding_transcript_exon_variant	Exon 19 of 35

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Jan 30, 2024

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The MYH9 c.3195_3215dup; p.Gln1068_Leu1074dup variant (rs876661302; ClinVar ID: 14085), also reported as E1066_A1072dup, is reported in an individual with moderate thrombocytopenia, large platelets and moderate/severe bleeding, but with no current extra-hematological symptoms (Bury 2020). This variant has also been reported to segregate with MYH9-related disease in three affected individuals of a family (De Rocco 2009). This variant duplicates seven amino acids leaving the rest of the protein in-frame. Based on available information, this variant is considered to be pathogenic. References: Bury L et al. Next-generation sequencing for the diagnosis of MYH9-RD: Predicting pathogenic variants. Hum Mutat. 2020 Jan;41(1):277-290. PMID: 31562665. De Rocco D et al. Identification of the first duplication in MYH9-related disease: a hot spot for unequal crossing-over within -

Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss Pathogenic:1

Jul 01, 2009

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs876661302; hg19: chr22-36692945;