NM_002473.6:c.3195_3215dupCGAGCTCCAGGCCCAGATCGC

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2PP5_ModerateBP3

The NM_002473.6(MYH9):​c.3195_3215dupCGAGCTCCAGGCCCAGATCGC​(p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

MYH9
NM_002473.6 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 3.87
Variant links:
Genes affected
MYH9 (HGNC:7579): (myosin heavy chain 9) This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 3 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 22-36296899-C-CGCGATCTGGGCCTGGAGCTCG is Pathogenic according to our data. Variant chr22-36296899-C-CGCGATCTGGGCCTGGAGCTCG is described in ClinVar as [Pathogenic]. Clinvar id is 14085.Status of the report is criteria_provided_single_submitter, 1 stars.
BP3
Nonframeshift variant in repetitive region in NM_002473.6

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYH9NM_002473.6 linkc.3195_3215dupCGAGCTCCAGGCCCAGATCGC p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla disruptive_inframe_insertion Exon 25 of 41 ENST00000216181.11 NP_002464.1 P35579-1A0A024R1N1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYH9ENST00000216181.11 linkc.3195_3215dupCGAGCTCCAGGCCCAGATCGC p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla disruptive_inframe_insertion Exon 25 of 41 1 NM_002473.6 ENSP00000216181.6 P35579-1
MYH9ENST00000685801.1 linkc.3258_3278dupCGAGCTCCAGGCCCAGATCGC p.Ala1093_Glu1094insGluLeuGlnAlaGlnIleAla disruptive_inframe_insertion Exon 26 of 42 ENSP00000510688.1 A0A8I5KWT8
MYH9ENST00000459960.1 linkn.404_424dupCGAGCTCCAGGCCCAGATCGC non_coding_transcript_exon_variant Exon 1 of 2 2
MYH9ENST00000691109.1 linkn.3490_3510dupCGAGCTCCAGGCCCAGATCGC non_coding_transcript_exon_variant Exon 19 of 35

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Jan 30, 2024
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The MYH9 c.3195_3215dup; p.Gln1068_Leu1074dup variant (rs876661302; ClinVar ID: 14085), also reported as E1066_A1072dup, is reported in an individual with moderate thrombocytopenia, large platelets and moderate/severe bleeding, but with no current extra-hematological symptoms (Bury 2020). This variant has also been reported to segregate with MYH9-related disease in three affected individuals of a family (De Rocco 2009). This variant duplicates seven amino acids leaving the rest of the protein in-frame. Based on available information, this variant is considered to be pathogenic. References: Bury L et al. Next-generation sequencing for the diagnosis of MYH9-RD: Predicting pathogenic variants. Hum Mutat. 2020 Jan;41(1):277-290. PMID: 31562665. De Rocco D et al. Identification of the first duplication in MYH9-related disease: a hot spot for unequal crossing-over within -

Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss Pathogenic:1
Jul 01, 2009
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs876661302; hg19: chr22-36692945; API