chr22-36296899-C-CGCGATCTGGGCCTGGAGCTCG

Position:

• chr22-36296899-C-CGCGATCTGGGCCTGGAGCTCG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 3P and 1B. PM2 PP5 BP3

The NM_002473.6(MYH9):​c.3195_3215dupCGAGCTCCAGGCCCAGATCGC​(p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYH9 NM_002473.6 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.87

Genes affected

MYH9 (HGNC:7579): (myosin heavy chain 9) This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 22-36296899-C-CGCGATCTGGGCCTGGAGCTCG is Pathogenic according to our data. Variant chr22-36296899-C-CGCGATCTGGGCCTGGAGCTCG is described in ClinVar as [Pathogenic]. Clinvar id is 14085.Status of the report is no_assertion_criteria_provided, 0 stars.
• BP3: Nonframeshift variant in repetitive region in NM_002473.6

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MYH9	NM_002473.6	c.3195_3215dupCGAGCTCCAGGCCCAGATCGC	p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla	disruptive_inframe_insertion	25/41	ENST00000216181.11	NP_002464.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MYH9	ENST00000216181.11	c.3195_3215dupCGAGCTCCAGGCCCAGATCGC	p.Ala1072_Glu1073insGluLeuGlnAlaGlnIleAla	disruptive_inframe_insertion	25/41	1	NM_002473.6	ENSP00000216181.6
MYH9	ENST00000685801.1	c.3258_3278dupCGAGCTCCAGGCCCAGATCGC	p.Ala1093_Glu1094insGluLeuGlnAlaGlnIleAla	disruptive_inframe_insertion	26/42			ENSP00000510688.1
MYH9	ENST00000459960.1	n.404_424dupCGAGCTCCAGGCCCAGATCGC		non_coding_transcript_exon_variant	1/2	2
MYH9	ENST00000691109.1	n.3490_3510dupCGAGCTCCAGGCCCAGATCGC		non_coding_transcript_exon_variant	19/35

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jul 01, 2009

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs876661302; hg19: chr22-36692945;