NM_002474.3:c.4661_4681dupAGCTGCAAGCCACGGAGGACG

Variant names:

• chr16-15720948-G-GCGTCCTCCGTGGCTTGCAGCT
• rs1555551958
• NM_002474.3:c.4661_4681dupAGCTGCAAGCCACGGAGGACG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_002474.3(MYH11):​c.4661_4681dupAGCTGCAAGCCACGGAGGACG​(p.Glu1554_Asp1560dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MYH11 NM_002474.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.91
• Publications: 0 publications found

Genes affected

MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]

NDE1 (HGNC:17619): (nudE neurodevelopment protein 1) This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

NDE1 Gene-Disease associations (from GenCC):

• lissencephaly 4

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine, Ambry Genetics
• microcephaly with lissencephaly and/or hydranencephaly

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• hydranencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• microlissencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• NDE1-related microhydranencephaly

  Inheritance: Unknown, AR Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002474.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002474.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYH11	NM_002474.3	MANE Select	c.4661_4681dupAGCTGCAAGCCACGGAGGACG	p.Glu1554_Asp1560dup	conservative_inframe_insertion	Exon 33 of 41	NP_002465.1	P35749-1
	MYH11	NM_001040113.2	MANE Plus Clinical	c.4682_4702dupAGCTGCAAGCCACGGAGGACG	p.Glu1561_Asp1567dup	conservative_inframe_insertion	Exon 34 of 43	NP_001035202.1	P35749-3
	NDE1	NM_017668.3	MANE Select	c.948-3234_948-3214dupGTGGCTTGCAGCTCGTCCTCC		intron	N/A	NP_060138.1	Q9NXR1-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYH11	ENST00000300036.6	TSL:1 MANE Select	c.4661_4681dupAGCTGCAAGCCACGGAGGACG	p.Glu1554_Asp1560dup	conservative_inframe_insertion	Exon 33 of 41	ENSP00000300036.5	P35749-1
	MYH11	ENST00000452625.7	TSL:1 MANE Plus Clinical	c.4682_4702dupAGCTGCAAGCCACGGAGGACG	p.Glu1561_Asp1567dup	conservative_inframe_insertion	Exon 34 of 43	ENSP00000407821.2	P35749-3
	MYH11	ENST00000396324.7	TSL:1	c.4682_4702dupAGCTGCAAGCCACGGAGGACG	p.Glu1561_Asp1567dup	conservative_inframe_insertion	Exon 34 of 42	ENSP00000379616.3	P35749-2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Aortic aneurysm, familial thoracic 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555551958; hg19: chr16-15814805;