chr16-15720948-G-GCGTCCTCCGTGGCTTGCAGCT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3

The NM_002474.3(MYH11):​c.4661_4681dupAGCTGCAAGCCACGGAGGACG​(p.Glu1554_Asp1560dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 31)

Consequence

MYH11
NM_002474.3 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 7.91

Publications

0 publications found
Variant links:
Genes affected
MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]
NDE1 (HGNC:17619): (nudE neurodevelopment protein 1) This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
NDE1 Gene-Disease associations (from GenCC):
  • lissencephaly 4
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
  • hydranencephaly
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • microlissencephaly
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • NDE1-related microhydranencephaly
    Inheritance: Unknown, AR Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_002474.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYH11NM_002474.3 linkc.4661_4681dupAGCTGCAAGCCACGGAGGACG p.Glu1554_Asp1560dup conservative_inframe_insertion Exon 33 of 41 ENST00000300036.6 NP_002465.1 P35749-1A0A024QZJ4
MYH11NM_001040113.2 linkc.4682_4702dupAGCTGCAAGCCACGGAGGACG p.Glu1561_Asp1567dup conservative_inframe_insertion Exon 34 of 43 ENST00000452625.7 NP_001035202.1 P35749-3
NDE1NM_017668.3 linkc.948-3234_948-3214dupGTGGCTTGCAGCTCGTCCTCC intron_variant Intron 8 of 8 ENST00000396354.6 NP_060138.1 Q9NXR1-2X5DR54

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYH11ENST00000300036.6 linkc.4661_4681dupAGCTGCAAGCCACGGAGGACG p.Glu1554_Asp1560dup conservative_inframe_insertion Exon 33 of 41 1 NM_002474.3 ENSP00000300036.5 P35749-1
MYH11ENST00000452625.7 linkc.4682_4702dupAGCTGCAAGCCACGGAGGACG p.Glu1561_Asp1567dup conservative_inframe_insertion Exon 34 of 43 1 NM_001040113.2 ENSP00000407821.2 P35749-3
NDE1ENST00000396354.6 linkc.948-3234_948-3214dupGTGGCTTGCAGCTCGTCCTCC intron_variant Intron 8 of 8 1 NM_017668.3 ENSP00000379642.1 Q9NXR1-2

Frequencies

GnomAD3 genomes
Cov.:
31
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Aortic aneurysm, familial thoracic 4 Uncertain:1
Mar 19, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.4682_4702dup, results in the insertion of 7 amino acid(s) of the MYH11 protein (p.Glu1561_Asp1567dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYH11-related conditions. ClinVar contains an entry for this variant (Variation ID: 465736). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555551958; hg19: chr16-15814805; API