NM_002485.5:c.2119_2141delGATCTAATAGCTCATCATGCTCG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_002485.5(NBN):c.2119_2141delGATCTAATAGCTCATCATGCTCG(p.Asp707LysfsTer27) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002485.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- Nijmegen breakage syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P, Orphanet, ClinGen
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- idiopathic aplastic anemiaInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
- prostate cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002485.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NBN | MANE Select | c.2119_2141delGATCTAATAGCTCATCATGCTCG | p.Asp707LysfsTer27 | frameshift | Exon 14 of 16 | NP_002476.2 | |||
| NBN | c.1873_1895delGATCTAATAGCTCATCATGCTCG | p.Asp625LysfsTer27 | frameshift | Exon 15 of 17 | NP_001019859.1 | A0A0C4DG07 | |||
| NBN | c.1873_1895delGATCTAATAGCTCATCATGCTCG | p.Asp625LysfsTer27 | frameshift | Exon 14 of 16 | NP_001427308.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NBN | TSL:1 MANE Select | c.2119_2141delGATCTAATAGCTCATCATGCTCG | p.Asp707LysfsTer27 | frameshift | Exon 14 of 16 | ENSP00000265433.4 | O60934 | ||
| NBN | c.2119_2141delGATCTAATAGCTCATCATGCTCG | p.Asp707LysfsTer20 | frameshift | Exon 14 of 15 | ENSP00000513244.1 | A0A8V8TKY5 | |||
| NBN | c.2119_2141delGATCTAATAGCTCATCATGCTCG | p.Asp707LysfsTer31 | frameshift | Exon 14 of 17 | ENSP00000513230.1 | A0A8V8TM80 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at