rs1554555782

Positions:

• chr8-89943295-TCGAGCATGATGAGCTATTAGATC-T

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_002485.5(NBN):​c.2119_2141delGATCTAATAGCTCATCATGCTCG​(p.Asp707fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: NBN NM_002485.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.66

Genes affected

NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]

NBN (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 8-89943295-TCGAGCATGATGAGCTATTAGATC-T is Pathogenic according to our data. Variant chr8-89943295-TCGAGCATGATGAGCTATTAGATC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 530717.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NBN	NM_002485.5	c.2119_2141delGATCTAATAGCTCATCATGCTCG	p.Asp707fs	frameshift_variant	14/16	ENST00000265433.8	NP_002476.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NBN	ENST00000265433.8	c.2119_2141delGATCTAATAGCTCATCATGCTCG	p.Asp707fs	frameshift_variant	14/16	1	NM_002485.5	ENSP00000265433.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Microcephaly, normal intelligence and immunodeficiency Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 07, 2021

This variant disrupts the ATM interaction domain of the NBN protein (PMID: 24894818, 21035407), which is important for activating ATM in the double-strand break repair pathway (PMID: 15964794, 15048089). While functional studies have not been performed to directly test the effect of this variant on NBN protein function, this suggests that disruption of this region of the protein is causative of disease. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. ClinVar contains an entry for this variant (Variation ID: 530717). This variant has not been reported in the literature in individuals affected with NBN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asp707Lysfs*27) in the NBN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 48 amino acid(s) of the NBN protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554555782; hg19: chr8-90955523;