NM_004937.3:c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_004937.3(CTNS):c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC(p.Lys187del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000559 in 1,610,954 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_004937.3 splice_donor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CTNS | NM_004937.3 | c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC | p.Lys187del | splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | Exon 8 of 12 | ENST00000046640.9 | NP_004928.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000201 AC: 3AN: 149270Hom.: 0 Cov.: 28
GnomAD3 exomes AF: 0.0000359 AC: 9AN: 250720Hom.: 0 AF XY: 0.0000221 AC XY: 3AN XY: 135752
GnomAD4 exome AF: 0.0000595 AC: 87AN: 1461684Hom.: 0 AF XY: 0.0000481 AC XY: 35AN XY: 727130
GnomAD4 genome AF: 0.0000201 AC: 3AN: 149270Hom.: 0 Cov.: 28 AF XY: 0.0000275 AC XY: 2AN XY: 72724
ClinVar
Submissions by phenotype
Nephropathic cystinosis Pathogenic:3
- -
- -
- -
Infantile nephropathic cystinosis Pathogenic:1
- -
CTNS-related disorder Pathogenic:1
The CTNS c.559_561+24del27 variant is predicted to result in a deletion affecting a canonical splice site. This variant is predicted to result in deletion of the last three nucleotides of exon 8 as well as the first twenty-four nucleotides of intron 8. This deletion encompasses the canonical splice donor site at the exon 8/intron 8 junction and is predicted to impact splicing (SpliceAI, Jaganathan et al. 2019. PubMed ID: 30661751). This variant has been reported in the homozygous and compound heterozygous states in multiple individuals with ocular or nephropathic cystinosis (Table 1, Attard et al. 1999. PubMed ID: 10556299; Browning et al. 2019. PubMed ID: 30957593; Table 2, Marik et al. 2022. PubMed ID: 35738466). This variant is reported in 0.0078% of alleles in individuals of European (non-Finnish) descent in gnomAD. Variants that disrupt the consensus splice donor site in CTNS are expected to be pathogenic. This variant is interpreted as pathogenic. -
Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis Pathogenic:1
- -
Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis Pathogenic:1
This variant results in the deletion of part of exon 8 of the CTNS gene. RNA analysis indicates that a similar copy number variant induces altered splicing and may result in an absent or altered protein product. This variant is present in population databases (rs771633120, gnomAD 0.008%). A similar copy number variant has been observed in individual(s) with infantile cystinosis (PMID: 11562417). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as 898–900_x0001_+24del27 . ClinVar contains an entry for this variant (Variation ID: 21442). Studies have shown that a similar copy number variant results in multiple aberrant spliced transcripts, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 11562417). For these reasons, this variant has been classified as Pathogenic. -
Cystinosis Pathogenic:1
This individual is heterozygous for the c.559_561+24del variant in the CTNS gene. This variant has been previously reported multiple times, as 898-900_24del27, in the literature as a known founder mutation, originating in Brittany, France. This deletion has been shown to abolish the splice donor consensus site of CTNS exon 8, resulting in aberrant transcript splicing (Kalatzis et al J Am Soc Nephrol 2001 (12):2170-2174; Attard et al Hum Mol Genetics 1999 8(13):2507-2514). This variant is considered to be pathogenic according to the ACMG guidelines. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at