chr17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G

Variant names:

• chr17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G
• rs113994211
• NM_004937.3:c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_004937.3(CTNS):​c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC​(p.Lys187del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000559 in 1,610,954 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 28)
  • Exomes 𝑓: 0.000060 (0 hom.)
• Consequence: CTNS NM_004937.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 7.75
• Publications: 2 publications found

Genes affected

CTNS (HGNC:2518): (cystinosin, lysosomal cystine transporter) This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

CTNS-AS1 (HGNC:56090): (CTNS antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G is Pathogenic according to our data. Variant chr17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 21442.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CTNS	NM_004937.3	c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC	p.Lys187del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 12	ENST00000046640.9	NP_004928.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CTNS	ENST00000046640.9	c.548_561+13delTGCCCTACATCAAGGTACGGCCTTGCC	p.Val183LysfsTer176	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 12	1	NM_004937.3	ENSP00000046640.4

Frequencies

GnomAD3 genomes AF: 0.0000201 AC: 3 AN: 149270 Hom.: 0 Cov.: 28

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000445

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000359 AC: 9 AN: 250720 AF XY: 0.0000221

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000795

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000595 AC: 87 AN: 1461684 Hom.: 0 AF XY: 0.0000481 AC XY: 35 AN XY: 727130

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53254

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000764 AC: 85 AN: 1111986

Other (OTH) AF: 0.0000331 AC: 2 AN: 60390

GnomAD4 genome AF: 0.0000201 AC: 3 AN: 149270 Hom.: 0 Cov.: 28 AF XY: 0.0000275 AC XY: 2 AN XY: 72724

African (AFR) AF: 0.00 AC: 0 AN: 40242

American (AMR) AF: 0.00 AC: 0 AN: 14888

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3450

East Asian (EAS) AF: 0.00 AC: 0 AN: 5000

South Asian (SAS) AF: 0.00 AC: 0 AN: 4620

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10350

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000445 AC: 3 AN: 67460

Other (OTH) AF: 0.00 AC: 0 AN: 2044

Alfa AF: 0.0000480 Hom.: 0

Bravo AF: 0.0000227

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Nephropathic cystinosis Pathogenic:3

Aug 11, 2011

GeneReviews

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Feb 05, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Feb 15, 2015

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Infantile nephropathic cystinosis Pathogenic:1

Mar 07, 2022

Laboratory of Cyto-molecular Genetics, Department of Anatomy, All India Institute of Medical Sciences (AIIMS), New Delhi

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

CTNS-related disorder Pathogenic:1

Jun 07, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The CTNS c.559_561+24del27 variant is predicted to result in a deletion affecting a canonical splice site. This variant is predicted to result in deletion of the last three nucleotides of exon 8 as well as the first twenty-four nucleotides of intron 8. This deletion encompasses the canonical splice donor site at the exon 8/intron 8 junction and is predicted to impact splicing (SpliceAI, Jaganathan et al. 2019. PubMed ID: 30661751). This variant has been reported in the homozygous and compound heterozygous states in multiple individuals with ocular or nephropathic cystinosis (Table 1, Attard et al. 1999. PubMed ID: 10556299; Browning et al. 2019. PubMed ID: 30957593; Table 2, Marik et al. 2022. PubMed ID: 35738466). This variant is reported in 0.0078% of alleles in individuals of European (non-Finnish) descent in gnomAD. Variants that disrupt the consensus splice donor site in CTNS are expected to be pathogenic. This variant is interpreted as pathogenic. -

Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis Pathogenic:1

Mar 02, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Nov 18, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site variant found to result in a null allele in a gene for which loss of function is a known mechanism of disease (PMID: 11562417); Not observed at significant frequency in large population cohorts (gnomAD); Also known as c.898-900+24del27; This variant is associated with the following publications: (PMID: 30957593, 35738466, 12442267, 11562417, 10556299, 34572146) -

Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis Pathogenic:1

Aug 28, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 8 of the CTNS gene. RNA analysis indicates that a similar copy number variant induces altered splicing and may result in an absent or altered protein product. This variant is present in population databases (rs771633120, gnomAD 0.008%). A similar copy number variant has been observed in individual(s) with infantile cystinosis (PMID: 11562417). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as 898–900_x0001_+24del27 . ClinVar contains an entry for this variant (Variation ID: 21442). Studies have shown that a similar copy number variant results in multiple aberrant spliced transcripts, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 11562417). For these reasons, this variant has been classified as Pathogenic. -

Cystinosis Pathogenic:1

Mar 12, 2018

Sydney Genome Diagnostics, Children's Hospital Westmead

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

This individual is heterozygous for the c.559_561+24del variant in the CTNS gene. This variant has been previously reported multiple times, as 898-900_24del27, in the literature as a known founder mutation, originating in Brittany, France. This deletion has been shown to abolish the splice donor consensus site of CTNS exon 8, resulting in aberrant transcript splicing (Kalatzis et al J Am Soc Nephrol 2001 (12):2170-2174; Attard et al Hum Mol Genetics 1999 8(13):2507-2514). This variant is considered to be pathogenic according to the ACMG guidelines. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113994211; hg19: chr17-3559866;