rs113994211

Variant names:

• chr17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G
• rs113994211
• NM_004937.3:c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC

Variant summary

Our verdict is Pathogenic. The variant received 20 ACMG points: 20P and 0B. PVS1 PS3 PP5_Very_Strong

The NM_004937.3(CTNS):​c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC​(p.Lys187del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000559 in 1,610,954 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000816935: Studies have shown that a similar copy number variant results in multiple aberrant spliced transcripts, and produces a non-functional protein and/or introduces a premature termination codon (PMID:11562417)." and additional evidence is available in ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 28)
  • Exomes 𝑓: 0.000060 (0 hom.)
• Consequence: CTNS NM_004937.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 7.75
• Publications: 2 publications found

Genes affected

CTNS (HGNC:2518): (cystinosin, lysosomal cystine transporter) This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

CTNS-AS1 (HGNC:56090): (CTNS antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 20 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000816935: Studies have shown that a similar copy number variant results in multiple aberrant spliced transcripts, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 11562417).; SCV001449313: This deletion has been shown to abolish the splice donor consensus site of CTNS exon 8, resulting in aberrant transcript splicing (Kalatzis et al J Am Soc Nephrol 2001 (12):2170-2174; Attard et al Hum Mol Genetics 1999 8(13):2507-2514).
• PP5: Variant 17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G is Pathogenic according to our data. Variant chr17-3656572-GTGCCCTACATCAAGGTACGGCCTTGCC-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 21442.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004937.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNS	NM_004937.3	MANE Select	c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC	p.Lys187del	splice_donor conservative_inframe_deletion splice_region intron	Exon 8 of 12	NP_004928.2	O60931-1
	CTNS	NM_001031681.3		c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC	p.Lys187del	splice_donor conservative_inframe_deletion splice_region intron	Exon 8 of 13	NP_001026851.2	O60931-2
	CTNS	NM_001374492.1		c.559_561+24delAAGGTACGGCCTTGCCTGCCCTACATC	p.Lys187del	splice_donor conservative_inframe_deletion splice_region intron	Exon 8 of 13	NP_001361421.1	O60931-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNS	ENST00000046640.9	TSL:1 MANE Select	c.548_561+13delTGCCCTACATCAAGGTACGGCCTTGCC	p.Val183LysfsTer176	frameshift splice_donor splice_region intron	Exon 8 of 12	ENSP00000046640.4	O60931-1
	CTNS	ENST00000381870.8	TSL:1	c.548_561+13delTGCCCTACATCAAGGTACGGCCTTGCC	p.Val183LysfsTer209	frameshift splice_donor splice_region intron	Exon 8 of 13	ENSP00000371294.3	O60931-2
	CTNS	ENST00000488623.6	TSL:3	c.-206_-193+13delTGCCCTACATCAAGGTACGGCCTTGCC		splice_region	Exon 7 of 11	ENSP00000501016.1	A0A669KAZ5

Frequencies

GnomAD3 genomes AF: 0.0000201 AC: 3 AN: 149270 Hom.: 0 Cov.: 28

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000445

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000359 AC: 9 AN: 250720 AF XY: 0.0000221

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000795

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000595 AC: 87 AN: 1461684 Hom.: 0 AF XY: 0.0000481 AC XY: 35 AN XY: 727130

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53254

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000764 AC: 85 AN: 1111986

Other (OTH) AF: 0.0000331 AC: 2 AN: 60390

GnomAD4 genome AF: 0.0000201 AC: 3 AN: 149270 Hom.: 0 Cov.: 28 AF XY: 0.0000275 AC XY: 2 AN XY: 72724

African (AFR) AF: 0.00 AC: 0 AN: 40242

American (AMR) AF: 0.00 AC: 0 AN: 14888

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3450

East Asian (EAS) AF: 0.00 AC: 0 AN: 5000

South Asian (SAS) AF: 0.00 AC: 0 AN: 4620

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10350

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000445 AC: 3 AN: 67460

Other (OTH) AF: 0.00 AC: 0 AN: 2044

Alfa AF: 0.0000480 Hom.: 0

Bravo AF: 0.0000227

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Nephropathic cystinosis (3)
1	-	-	CTNS-related disorder (1)
1	-	-	Cystinosis (1)
1	-	-	Infantile nephropathic cystinosis (1)
1	-	-	Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis (1)
1	-	-	Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113994211; hg19: chr17-3559866;