NM_005222.4:c.75_98dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr7-97006051-G-GGCAGCAGCAGCAGCAGCAGCAGCA
• rs530625473
• NM_005222.4:c.75_98dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_005222.4(DLX6):​c.75_98dupGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln33_Gln34insGlnGlnGlnGlnGlnGlnGlnGln) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000267 in 150,048 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000027 (0 hom., cov: 29)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: DLX6 NM_005222.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.11

Genes affected

DLX6 (HGNC:2919): (distal-less homeobox 6) This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]

DLX6-AS1 (HGNC:37151): (DLX6 antisense RNA 1) Predicted to act upstream of or within positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_005222.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DLX6	NM_005222.4	c.75_98dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln33_Gln34insGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 1 of 3	ENST00000518156.3	NP_005213.3
DLX6-AS1	NR_015448.1	n.141+7850_141+7873dupTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant	Intron 1 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DLX6	ENST00000518156.3	c.75_98dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln33_Gln34insGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 1 of 3	1	NM_005222.4	ENSP00000428480.2

Frequencies

GnomAD3 genomes AF: 0.0000267 AC: 4 AN: 150048 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.0000244

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000133

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000485

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.98e-7 AC: 1 AN: 1432004 Hom.: 0 Cov.: 34 AF XY: 0.00 AC XY: 0 AN XY: 710120

Gnomad4 AFR exome AF: 0.0000305

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000267 AC: 4 AN: 150048 Hom.: 0 Cov.: 29 AF XY: 0.0000273 AC XY: 2 AN XY: 73220

Gnomad4 AFR AF: 0.0000244

Gnomad4 AMR AF: 0.000133

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.000485

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs530625473; hg19: chr7-96635363;