NM_005222.4:c.78_98delGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_005222.4(DLX6):c.78_98delGCAGCAGCAGCAGCAGCAGCA(p.Gln27_Gln33del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000759 in 1,582,052 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_005222.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005222.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DLX6 | NM_005222.4 | MANE Select | c.78_98delGCAGCAGCAGCAGCAGCAGCA | p.Gln27_Gln33del | disruptive_inframe_deletion | Exon 1 of 3 | NP_005213.3 | ||
| DLX6-AS1 | NR_015448.1 | n.141+7853_141+7873delTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DLX6 | ENST00000518156.3 | TSL:1 MANE Select | c.78_98delGCAGCAGCAGCAGCAGCAGCA | p.Gln27_Gln33del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000428480.2 | P56179-3 | |
| DLX6-AS1 | ENST00000458352.5 | TSL:1 | n.615+5753_615+5773delTGCTGCTGCTGCTGCTGCTGC | intron | N/A | ||||
| DLX6-AS1 | ENST00000430027.3 | TSL:2 | n.141+7853_141+7873delTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.0000133 AC: 2AN: 150048Hom.: 0 Cov.: 29 show subpopulations
GnomAD4 exome AF: 0.00000698 AC: 10AN: 1432004Hom.: 0 AF XY: 0.00000986 AC XY: 7AN XY: 710120 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000133 AC: 2AN: 150048Hom.: 0 Cov.: 29 AF XY: 0.0000273 AC XY: 2AN XY: 73220 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at